ID: 1170699278

View in Genome Browser
Species Human (GRCh38)
Location 20:18688825-18688847
Sequence CAGAATATTGAGTAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170699274_1170699278 -5 Left 1170699274 20:18688807-18688829 CCTGGGAGAAAATGCCCGCAGAA 0: 1
1: 0
2: 2
3: 13
4: 123
Right 1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
1170699267_1170699278 30 Left 1170699267 20:18688772-18688794 CCAGGAATGTGGTGTTTAATTGG 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
1170699273_1170699278 2 Left 1170699273 20:18688800-18688822 CCGTGTACCTGGGAGAAAATGCC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202
1170699272_1170699278 3 Left 1170699272 20:18688799-18688821 CCCGTGTACCTGGGAGAAAATGC 0: 1
1: 0
2: 2
3: 14
4: 381
Right 1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170699278 Original CRISPR CAGAATATTGAGTAGGAAGC AGG Intronic
904111065 1:28126520-28126542 CAGAATAATGTGGAGGAAGGAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
906458344 1:46017925-46017947 CAGAAGATTGAGTAGTAAATAGG - Intronic
906693636 1:47809675-47809697 CGGAATACTGAACAGGAAGCAGG - Intronic
908028562 1:59975857-59975879 CAGAATATAGAAGAGGAAGAAGG - Intergenic
909459045 1:75887746-75887768 CAGAATCTTAAGAAGGTAGCAGG + Intronic
911710378 1:101064673-101064695 CAAAATATTAAGAAGGTAGCTGG - Intergenic
912256941 1:108069800-108069822 CAGAATATAGAGTGGAAAGAGGG - Intergenic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913200505 1:116492373-116492395 CACAACTTTGAGTAGGAAGAGGG - Intergenic
915742552 1:158130207-158130229 GAGAATATGGAGTGGGGAGCTGG - Intergenic
916624668 1:166542221-166542243 CAGAATTTTGAGTTGAATGCAGG + Intergenic
917270713 1:173270427-173270449 CAGAAGGTTGAGGAGGAAGCAGG + Intergenic
918153190 1:181816869-181816891 CTGAAGGTTGAGTAGGAAGCTGG - Intergenic
920186335 1:204161633-204161655 CAAAACATTGAGAATGAAGCAGG + Intronic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
922471620 1:225880613-225880635 CGGCATATTGAGTAGGAATAAGG - Intronic
922660519 1:227425827-227425849 CAGATAAATGACTAGGAAGCAGG + Intergenic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
924480114 1:244422653-244422675 CAAAATATTGAGTAGGGAGCAGG - Intronic
1064709696 10:18110727-18110749 CAGAGAAGTGAGTAGGAAACAGG + Intergenic
1067897454 10:50199683-50199705 GAGAATGTTGTGGAGGAAGCTGG - Intronic
1067951519 10:50742356-50742378 GAGAATGTTGTGGAGGAAGCTGG + Intronic
1068826712 10:61448259-61448281 CAGAATATTGGGTCGGGAACAGG - Intronic
1071092936 10:81941212-81941234 GAGAATATGAAGTAGGAAGATGG + Intronic
1071096838 10:81985616-81985638 TTGAAAAGTGAGTAGGAAGCAGG + Intronic
1071428160 10:85580435-85580457 CAGAATACTGAGAACTAAGCAGG - Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1076271098 10:129152815-129152837 CAGAATATTCAGTGCTAAGCTGG + Intergenic
1076941574 10:133613587-133613609 CAGAATATAGATAAGGGAGCTGG + Intergenic
1078849276 11:15149322-15149344 CAGAAAATTGCGTGGGAAGATGG - Intronic
1079733870 11:23971089-23971111 CAAAATATGGATTAGGCAGCAGG + Intergenic
1080715336 11:34794628-34794650 CAGAATATCGAGAGAGAAGCAGG + Intergenic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081058043 11:38435184-38435206 GAAAATATTGAGTAGGTACCTGG + Intergenic
1081726669 11:45334599-45334621 GAGAAGGTTGAGTAGGAGGCGGG + Intergenic
1083948179 11:65937757-65937779 CAGTAAATAGAGTAGGAATCAGG - Intergenic
1084923031 11:72487273-72487295 GAGAAGACTGAGTAGGGAGCTGG + Intergenic
1085863581 11:80261990-80262012 GAGAAGATTGAATAGGGAGCTGG - Intergenic
1086163383 11:83748488-83748510 GAGCATTTTGAGTAGGAAGTGGG - Intronic
1086799585 11:91155113-91155135 GGGAATGTTGAGGAGGAAGCAGG + Intergenic
1087708206 11:101519680-101519702 CAGAATTTTGAAAAGTAAGCAGG - Intronic
1088029227 11:105225887-105225909 TATAATATTGATTAGGAACCAGG + Intergenic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1093776938 12:23086618-23086640 CTGAATATTGAGTACAAAGCAGG - Intergenic
1093994359 12:25625648-25625670 CAGAAAGATGAGTAGTAAGCCGG - Intronic
1096730142 12:53603495-53603517 CAGCAAATTTAGAAGGAAGCAGG - Intronic
1096837906 12:54362829-54362851 CAGAATGTTGAGCAGCAAGAAGG + Exonic
1099140275 12:78965414-78965436 ACAAATATTCAGTAGGAAGCTGG - Intronic
1100631357 12:96392715-96392737 GGCAATATCGAGTAGGAAGCTGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1105340211 13:19516258-19516280 CAAAACATTCAGTAGCAAGCAGG + Intronic
1106595082 13:31128746-31128768 TAGAAAATTGAGTGGGAAACTGG - Intergenic
1107193859 13:37623338-37623360 AAAAAAATTGAGTAGGAAGATGG - Intergenic
1107354689 13:39554457-39554479 CAGAACATTCTGTAGGAAACTGG - Intronic
1108274724 13:48796296-48796318 GAGAAGATTGTGGAGGAAGCAGG - Intergenic
1108634766 13:52322416-52322438 CAAAACATTCAGTAGCAAGCAGG + Intergenic
1108653041 13:52500772-52500794 CAAAACATTCAGTAGCAAGCAGG - Intergenic
1108755016 13:53489712-53489734 AAGAACTTTGAGTAGGAAGATGG - Intergenic
1110107622 13:71697445-71697467 CAGAATATTCAGTGGGAGACAGG - Intronic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1111828130 13:93294828-93294850 CAGAATAATCAGTAGGTAGTTGG - Intronic
1113399663 13:109979259-109979281 CAGCATTTTGAGTATGAAACAGG + Intergenic
1114598332 14:23933510-23933532 CAGAATACTGAGTGGGGAGGGGG + Intergenic
1114731500 14:24997449-24997471 CAAAATATTCAGTAGGAATAAGG - Intronic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1117729117 14:58703786-58703808 CTGAATTCTGAGTGGGAAGCTGG + Intergenic
1117823449 14:59675354-59675376 CAGAATGCTCAGTAGGAAGCTGG + Intronic
1118451883 14:65910519-65910541 CAAAATATTATGTAGGGAGCGGG - Intergenic
1124196185 15:27631886-27631908 GAGAATTACGAGTAGGAAGCGGG - Intergenic
1127710896 15:61597050-61597072 CAGAATACTGAGTATGAATATGG - Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1128996684 15:72302239-72302261 CTGAATATATAGTAGGGAGCAGG + Intronic
1130793695 15:87185768-87185790 TTAAATATTGAGTAGGAAGTTGG - Intergenic
1133714762 16:8436851-8436873 CAGAATAGTGAGTAGGTAGAGGG + Intergenic
1137870749 16:51947816-51947838 CAGAATATTGAGTAAGGACCAGG - Intergenic
1138236782 16:55390261-55390283 AAGGCTATTTAGTAGGAAGCTGG - Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139778876 16:69334605-69334627 CAGAATATTGTTGAGAAAGCAGG + Exonic
1141809225 16:86363476-86363498 CAGCATATTGAGTGGGATGAAGG + Intergenic
1141933886 16:87223380-87223402 TAGGTTATTGAGTAGGAAGTTGG - Intronic
1142663829 17:1450085-1450107 CAGCCTCTTGAGTAGGTAGCTGG - Intronic
1144031610 17:11328173-11328195 CAGCATATTGGGTAGGAAATTGG + Intronic
1145293912 17:21573574-21573596 CACAATCTTGAAGAGGAAGCCGG - Intronic
1146636907 17:34513314-34513336 CAGATTTATGAGTAGGAAGACGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1151290670 17:73147725-73147747 CAGCATGTTGAGGAGGAAGGCGG - Intergenic
1151712553 17:75814999-75815021 CAGGAGTTTGAGTAAGAAGCTGG + Intronic
1157998967 18:52594026-52594048 CAAAATAGGGAGTAGGCAGCTGG + Intronic
1158655734 18:59330827-59330849 CAGAATATTGACCAGTAAGAGGG - Exonic
1161619146 19:5289296-5289318 CAGAAGAATGAGTAAGAAGTGGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1164093618 19:21984009-21984031 CAGAATATTAATAAGGAAACAGG + Intronic
1167804633 19:51772308-51772330 AAGAATATTGGGTAGGCAGCTGG - Intronic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
926624073 2:15075601-15075623 CAAAAGATTGAGTAGGAAATTGG - Intergenic
926971889 2:18474783-18474805 CAGATAATAGGGTAGGAAGCAGG + Intergenic
927923198 2:26989848-26989870 CAGAATATTGAGTTAGGAGATGG + Intronic
928235364 2:29534578-29534600 CAGAATGTTGAGTAGAAACCAGG + Intronic
929308200 2:40390394-40390416 TAGAATAATTAGCAGGAAGCAGG - Intronic
931616705 2:64166583-64166605 CAGAATATTGAGGAAGTAGAGGG - Intergenic
933271035 2:80233112-80233134 CTGAAAATTCAGTAGGAACCTGG + Intronic
936823354 2:116551651-116551673 AAGAATTTTGAGTAGGATGATGG - Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
940665597 2:156605329-156605351 CAGAATATTGAGTATCAACAGGG - Intronic
941393647 2:164947564-164947586 CAAAATATTTATTAGGCAGCTGG - Intronic
941511905 2:166422047-166422069 CAGAACAGTGACTAGGAAACAGG + Intronic
941992658 2:171572276-171572298 CAGCAAATAAAGTAGGAAGCAGG + Intergenic
942062639 2:172241767-172241789 TAGAATATAGAGGAGGCAGCTGG - Intergenic
943496948 2:188631919-188631941 CATAACATTTAGTAGTAAGCAGG - Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
948315027 2:237021930-237021952 CAGTATATTGAGTATGAATTTGG + Intergenic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1171888211 20:30677437-30677459 AAGAATCTTGAGTGGGAAGAAGG - Intergenic
1177058791 21:16343985-16344007 CAGCATAATGAGTAGGGAGAAGG + Intergenic
1179175466 21:39005039-39005061 CAGAGCCTTGAGCAGGAAGCGGG + Intergenic
1179343201 21:40531847-40531869 CAGAGCATTGAGTGGGATGCTGG - Intronic
1180561746 22:16620980-16621002 CAAAACATTCAGTAGCAAGCAGG - Intergenic
949913569 3:8937550-8937572 CAGAATATTGTGGAGGAGACAGG + Intronic
950805820 3:15602251-15602273 CTGAATAGTGGGTAGGAAACAGG - Intronic
951038534 3:17962440-17962462 GATAATATTGAGTAGGCAGTTGG + Intronic
952381807 3:32811189-32811211 CAGCATTTGGAGTAAGAAGCTGG + Intergenic
952801023 3:37292020-37292042 CAGAATAGTGTATAGGTAGCCGG + Intronic
953292191 3:41676826-41676848 CAGCATACTGGGCAGGAAGCAGG - Intronic
958120986 3:89287827-89287849 GAGAATCTTGAGTGGGAAGAAGG - Intronic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
960858520 3:122127530-122127552 CAGAGTATGGAGCAAGAAGCAGG + Intergenic
961083376 3:124045095-124045117 CACAATATTGAGTTGGCAGCTGG + Intergenic
961196655 3:125007646-125007668 AATAATCTTGAGTGGGAAGCAGG + Intronic
962886146 3:139629711-139629733 TAGAATATAAAGTAGGAAACTGG - Intronic
963441820 3:145349574-145349596 TAGAAAATTGAGAAGCAAGCAGG + Intergenic
965133918 3:164737922-164737944 CAGAATATTGAGGATCAAGATGG - Intergenic
966323583 3:178729333-178729355 CACAGTATTGATTAGGAAGATGG + Intronic
968219724 3:196927662-196927684 CAGAATATGCATTAAGAAGCTGG - Intronic
970323467 4:14898694-14898716 GAAAATATTGAGTAGGCAGCTGG + Intergenic
971024270 4:22572546-22572568 AAGAATATAAAGTAGGAGGCCGG - Intergenic
973795409 4:54420499-54420521 CAGAAGAATGGGTAGGAATCAGG - Intergenic
975218669 4:71787907-71787929 TGGAATTTTGAGTAGGCAGCTGG + Intronic
975469303 4:74747002-74747024 CAGAATAGTGAGCAGAAAGAGGG + Intronic
975665183 4:76728055-76728077 CAGCATCCTGAGTAGGAGGCTGG - Intronic
976096527 4:81514039-81514061 CAAAATATTGAGTAAAAAGAGGG + Intronic
977740936 4:100481574-100481596 CACAATATTCAGCAGGGAGCAGG + Intronic
978041415 4:104068373-104068395 CAGAGTAGTGAGTAGAAACCAGG - Intergenic
978381507 4:108133724-108133746 GAGTTTATTGAGTAGGAAACTGG - Intronic
979089659 4:116465930-116465952 CAGCTTCTTTAGTAGGAAGCTGG - Intergenic
980425800 4:132626959-132626981 AATAATATTGAGTAGGAACCCGG - Intergenic
981612399 4:146608926-146608948 CAGAAGATTGAGCTGGAAGTAGG - Intergenic
981957830 4:150500929-150500951 CTTAATATTTAGTAGGAGGCAGG - Intronic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982805845 4:159761389-159761411 CAGAATAGTAAGTTGGAAACTGG + Intergenic
983206539 4:164916396-164916418 CAGAATATTGTGGAGGCAGATGG - Intergenic
983212086 4:164969150-164969172 CAGAATATTGTGGAGGCAGATGG + Intronic
984108956 4:175584824-175584846 CAGAGTTTTGAGTATGAAGGAGG + Intergenic
986063342 5:4212342-4212364 CAGGAAGTTGAGGAGGAAGCTGG + Intergenic
986913014 5:12580565-12580587 AAGAATATGGAGTAAAAAGCCGG - Intergenic
989242787 5:39219672-39219694 CAGGATATTGAGTAATAAGGAGG + Intronic
989697886 5:44225016-44225038 CAGAATCATGAGTTGGAAGAAGG - Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990503359 5:56419743-56419765 CAGAAAAGAGAATAGGAAGCAGG - Intergenic
992695517 5:79282586-79282608 AAGAATTTTCAGTAGGAAGTGGG + Intronic
992718441 5:79534504-79534526 AAGAATATAGAGTAGTTAGCAGG - Intergenic
993095769 5:83475786-83475808 GAGAAGATTAGGTAGGAAGCGGG + Intronic
994437244 5:99753597-99753619 CAGAATTTAGAGTAAGAAGCTGG - Intergenic
996350597 5:122537029-122537051 GAGTATATTTAGTAGTAAGCCGG - Intergenic
997223287 5:132188462-132188484 CAGAATATTGAATAAGAGGGAGG + Intergenic
997587010 5:135049192-135049214 CAGAAGTGTGAGCAGGAAGCAGG - Intronic
997990340 5:138539658-138539680 CAGAAGATTAAGTATGATGCTGG + Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002380198 5:178822142-178822164 CAGAAAATTAACAAGGAAGCTGG - Intergenic
1002664901 5:180815910-180815932 CAGAATATTCAGCAGGAACATGG + Intergenic
1004526604 6:16414799-16414821 CAACATATTGAGTAGAAAGAAGG - Intronic
1004538517 6:16526466-16526488 TAGAATATTCAGTAGGTGGCCGG + Intronic
1005423269 6:25674764-25674786 CAGAACATTAATTAGGAATCAGG - Intronic
1008241775 6:49122029-49122051 CAGGAGATTGAGTAGGCAACTGG + Intergenic
1009906530 6:69875786-69875808 GAGAATTTTGAATAGGCAGCTGG + Intronic
1010917174 6:81634401-81634423 CAGAATACTGAGTGGTAAGCAGG - Intronic
1011392420 6:86868245-86868267 CAGAGTATTGAGCAGGAACATGG + Intergenic
1011509341 6:88082735-88082757 CAGAAAATTGAGTAAGAGGATGG + Intergenic
1015515951 6:134082753-134082775 CAGTAAATAAAGTAGGAAGCAGG + Intergenic
1015906284 6:138120248-138120270 TAGAATATTAAGTAGGATACAGG + Intergenic
1018292071 6:162301922-162301944 GAGAATATTGCGTAGGTAGTTGG - Intronic
1020059722 7:5143410-5143432 GAGAAAATTGAGTAGGGAGACGG - Intergenic
1021041504 7:15868153-15868175 CAGAATATTGATTAAGACCCTGG - Intergenic
1022286741 7:28960926-28960948 GAGAACTCTGAGTAGGAAGCGGG - Intergenic
1023002462 7:35824401-35824423 CAGCATACAGAGTAGGAAGCAGG - Intronic
1029528654 7:101110913-101110935 TAGAATAATGAGTATGAAACAGG + Intergenic
1031446923 7:121866117-121866139 CAGCACATTCAGTAGGAAGGCGG + Intergenic
1032748791 7:134815013-134815035 GAGAATAAAGGGTAGGAAGCAGG - Intronic
1036576905 8:10036173-10036195 CAGAATGTTGAGTAGAAATGTGG - Intergenic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1041080001 8:54207106-54207128 CAGAGTATTCAGTAGTGAGCAGG - Intergenic
1042300626 8:67276611-67276633 CAAAATATAGGGTAGGAAGGAGG + Intronic
1042544824 8:69942127-69942149 CAGAATATACAGTCAGAAGCGGG - Intergenic
1043881081 8:85543717-85543739 TAGGAATTTGAGTAGGAAGCTGG - Intergenic
1044623493 8:94213835-94213857 CAGAGTATTGGCAAGGAAGCCGG - Intronic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1046021450 8:108670297-108670319 CAGAACATTGAGTAGGCATTGGG + Intronic
1046526513 8:115387998-115388020 CAGAAGATTGTGGAAGAAGCTGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047835783 8:128689149-128689171 GAGGAAATGGAGTAGGAAGCTGG + Intergenic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1051454025 9:17231836-17231858 AATAATAGTGAGTATGAAGCAGG - Intronic
1051834774 9:21323301-21323323 CAGAAGTTAGAATAGGAAGCAGG + Intergenic
1051845821 9:21450013-21450035 CAGAATATTGGGAAGGATGGGGG + Intergenic
1052818528 9:33120883-33120905 CAGAATAATCAGTAGGGAACTGG + Intronic
1054853755 9:69875650-69875672 CATAACTTTGAGTAGGAAGAGGG + Intronic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1057104924 9:92405674-92405696 CAAGATATTGAGAAGTAAGCTGG + Intronic
1058117363 9:101099356-101099378 CTAAATATTGACTAGGAAGAAGG + Intronic
1060965930 9:127712324-127712346 CAGAATGTTCTGTAGGAAGGAGG - Exonic
1062236167 9:135508778-135508800 CAGAATCTTGAGTGAGAATCAGG + Intergenic
1203557811 Un_KI270744v1:15303-15325 AAGAATATTGAGTGAGAAGAAGG - Intergenic
1186548355 X:10475703-10475725 CGGAGTATTGCGTAGGATGCTGG + Intronic
1186617502 X:11204718-11204740 CAGAAGACTAAGTAGGTAGCTGG - Intronic
1194763283 X:97819258-97819280 TGGAATATTAAGTAGCAAGCTGG - Intergenic
1198385701 X:136127558-136127580 TAGAGTATTGAGTAGGTGGCGGG + Intergenic
1198417036 X:136430772-136430794 GATGATATTGAGTAGGAAGTTGG + Intergenic
1199943434 X:152647208-152647230 TAGAATATTCAGTAGGAAGAAGG - Intronic