ID: 1170701238

View in Genome Browser
Species Human (GRCh38)
Location 20:18705529-18705551
Sequence GGTACCATGGTAGCTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170701232_1170701238 0 Left 1170701232 20:18705506-18705528 CCAGGAAGCTACCGCCAGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 128
1170701230_1170701238 2 Left 1170701230 20:18705504-18705526 CCCCAGGAAGCTACCGCCAGGTT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 128
1170701231_1170701238 1 Left 1170701231 20:18705505-18705527 CCCAGGAAGCTACCGCCAGGTTC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170701238 Original CRISPR GGTACCATGGTAGCTGGTAG TGG Intronic
901120094 1:6884202-6884224 GACACCATGGCAGTTGGTAGAGG + Intronic
905083400 1:35346261-35346283 TGCACCATGGTGGCTGGAAGTGG + Intronic
907594203 1:55704665-55704687 GGTACCTCAGTAGGTGGTAGTGG + Intergenic
908704554 1:66937157-66937179 GGTTCCATGGTAGGTGGTGAAGG - Intronic
909837644 1:80276834-80276856 GGCACCATGGTAGTTCCTAGGGG - Intergenic
915808195 1:158876932-158876954 GGGACTATGGCAGCTGGTACTGG + Intergenic
918699590 1:187591202-187591224 AGTAGAATGGTAGTTGGTAGGGG - Intergenic
923312399 1:232747640-232747662 ACTACCATGCTAGCTGGAAGAGG - Intergenic
924014895 1:239710815-239710837 GGTACCAGGGTACATGGTTGAGG - Intronic
1063074618 10:2702099-2702121 GAAACCATGGAAGCTGGTAACGG + Intergenic
1064357778 10:14635216-14635238 GGGGCCATGGCAGCTGGAAGCGG + Intronic
1064478326 10:15715509-15715531 CGTACAGTGGTAGGTGGTAGAGG - Intronic
1064665845 10:17650584-17650606 GGTACCAGGGTATCTGGCACAGG - Intronic
1066010534 10:31190111-31190133 GGTGACAGGGTAGCTGGCAGTGG + Intergenic
1066685206 10:37975418-37975440 AGCACCATGCTAGCTGGAAGTGG - Intronic
1067032038 10:42884641-42884663 GGGACCAGGGTGGCTGGTGGTGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067795222 10:49316312-49316334 GGTACCATGGGGGCTGGGGGTGG + Intronic
1069512462 10:69052613-69052635 GGTACAAAGGCAGCTGGGAGAGG - Intergenic
1074326736 10:112457846-112457868 GGTGCCATGGGAGCCAGTAGAGG + Intronic
1077284347 11:1759156-1759178 GGCTCCATGGTAGATTGTAGGGG - Intronic
1083174902 11:60943537-60943559 GGCCCCATGCTAGCTGGTACGGG + Intronic
1083519811 11:63298486-63298508 GTTACCAGCATAGCTGGTAGTGG + Intronic
1085734058 11:79023912-79023934 GGTGCCATCGTATCTGGTAGTGG - Intronic
1086297596 11:85388146-85388168 GGTGGCATGGGAGCTGGTTGAGG + Intronic
1086811316 11:91313980-91314002 GGTAGAGTGGGAGCTGGTAGTGG - Intergenic
1092990693 12:13895886-13895908 GGTACTATGGTATGTGGCAGAGG + Intronic
1093527337 12:20117088-20117110 GGTACGATGATAGCAGGCAGAGG - Intergenic
1096868023 12:54576705-54576727 GGTACCATGGCAGAGGGCAGGGG + Intronic
1098439783 12:70505092-70505114 GATACCTTGGTTGCTGGTACAGG + Intergenic
1101799505 12:108008569-108008591 GGTTCCATGGGAGATGGTATGGG - Intergenic
1104771840 12:131368727-131368749 GGCACTCTGGGAGCTGGTAGTGG + Intergenic
1104879601 12:132061451-132061473 GGAACCAAGGGAGCTGGCAGAGG + Intronic
1106452344 13:29894503-29894525 GGGACCATGCAAGCAGGTAGAGG + Intergenic
1109078501 13:57867675-57867697 TGTTTCATGGTAGCTGGTATTGG - Intergenic
1112127487 13:96484520-96484542 AGTACAATGGTAGTTGGTGGCGG - Intronic
1112982418 13:105401751-105401773 AGTACAATGGTAGCTGTCAGAGG - Intergenic
1114705849 14:24726327-24726349 GGTACCTTGGTTGCTGGTGAAGG - Intergenic
1117580135 14:57143614-57143636 GCTGCCATGGTAGGTGGTAGAGG - Intergenic
1117630972 14:57690997-57691019 GGTACCATGGTATCGGTTTGTGG + Intronic
1120848451 14:89147201-89147223 GGTACCTTGGTAGCAGGGAGTGG + Intronic
1123425014 15:20163925-20163947 GGCACAATGGCAGCTGGGAGGGG + Intergenic
1123534238 15:21170458-21170480 GGCACAATGGCAGCTGGGAGGGG + Intergenic
1125040370 15:35178866-35178888 GGTACTATACTAGCTGGTTGGGG - Intergenic
1126284701 15:46997150-46997172 GATACCTTGGTAGCTGGTGCAGG + Intergenic
1126579229 15:50227782-50227804 GGCACCATGGTAGGTGCTGGGGG - Intronic
1127627946 15:60798675-60798697 GGCAGCATGGTAGCGGGGAGGGG + Intronic
1128296452 15:66524710-66524732 GGTACTATGCTAGATGGTAAGGG - Intronic
1129649546 15:77472919-77472941 GGTATCATGATAGGTGGTATGGG - Intronic
1129680121 15:77654118-77654140 GTTACCATGGTAGCAGGAAGAGG - Intronic
1132858116 16:2056520-2056542 GGTGCCATGGCAGCGGGGAGAGG + Intronic
1134835958 16:17360906-17360928 GGTTCCATGGTTACTGGTACCGG - Intronic
1135002888 16:18791354-18791376 GGTACCATGCTAGAGGGAAGAGG - Intronic
1136859843 16:33691820-33691842 GGCACAATGGCAGCTGGGAGGGG - Intergenic
1141648625 16:85380515-85380537 GGTACCAGGGTGGCGGGTGGAGG - Intergenic
1203121348 16_KI270728v1_random:1539999-1540021 GGCACAATGGCAGCTGGGAGGGG - Intergenic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1145187298 17:20806103-20806125 GGTAACATGGCAGCTGCTACTGG - Intergenic
1146077577 17:29745448-29745470 GGTATCATTGTAGCTGGGTGCGG - Intronic
1147381605 17:40059667-40059689 TGTTCCATGGTGGCTGGTAGAGG + Intronic
1147669070 17:42166258-42166280 GGTTCCAGGGTAGGTAGTAGAGG + Intronic
1148712657 17:49692999-49693021 GGTACCATGGAGGCTGGGGGTGG + Intergenic
1148934770 17:51156223-51156245 GGTATCATAGGAGCTGGTGGAGG + Intronic
1149040997 17:52187902-52187924 GGTACCATGGTACCGGTTAGTGG + Intergenic
1149531816 17:57401803-57401825 GCTCCCATGGAAGCTGCTAGAGG + Intronic
1156519635 18:37711283-37711305 GGCATCATGGTCTCTGGTAGTGG + Intergenic
1157272873 18:46290133-46290155 GGTACGATGGGAGCTGGGGGTGG - Intergenic
1158590657 18:58776058-58776080 GGCACTGTGCTAGCTGGTAGGGG + Intergenic
1158826872 18:61231336-61231358 GGTACCATGCTAGGTGCTGGTGG - Intergenic
1168410268 19:56135537-56135559 GGTACCATGAGGGCTGGTAGTGG - Intronic
926014192 2:9434880-9434902 GGGAACATGGTAGGTGGTGGAGG - Intronic
926592083 2:14750854-14750876 GATTCCAAGGCAGCTGGTAGTGG - Intergenic
928092084 2:28381116-28381138 GCTAGCATGGTATCTGGTACAGG - Intergenic
936173684 2:110199501-110199523 GCTAGCATGGTAGCTCGTGGCGG + Intronic
938305479 2:130251689-130251711 GGGACTATGGCAGCTGCTAGTGG - Intergenic
939622430 2:144436605-144436627 GGTTCCCTGGTACCTGGGAGAGG + Intronic
946916108 2:224523878-224523900 GGTAGAATGGTAGCTGGCAGAGG + Intronic
947865736 2:233397052-233397074 GGGACCAGGGTGGCTGGCAGAGG + Intronic
947865798 2:233397241-233397263 GGGACCAGGGTGGCTGGCAGAGG + Intronic
947865843 2:233397380-233397402 GGGACCAGGGTGGCTGGCAGAGG + Intronic
947865855 2:233397425-233397447 GGGACCAGGGTGGCTGGCAGAGG + Intronic
947888321 2:233594036-233594058 GGGACCGTGATAGCTGGTGGGGG - Intergenic
1169181471 20:3572524-3572546 TGTATCATGGTAGCTGGATGTGG + Intronic
1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG + Intronic
1175285814 20:57836159-57836181 GGTCCCATGGGAACTGTTAGGGG - Intergenic
1180130678 21:45825045-45825067 GGCACCCTGGTACCTGGCAGGGG + Intronic
1182935642 22:34219281-34219303 GGTACCATGGAAACAGGGAGAGG - Intergenic
949191510 3:1255084-1255106 TTTACCATGGTAGCTGGGTGGGG + Intronic
951159508 3:19400205-19400227 GCTAACATCGTATCTGGTAGGGG - Intronic
953641342 3:44711095-44711117 GGCACCAGGGAAGGTGGTAGGGG - Intergenic
955640345 3:61076175-61076197 GCCTCCATCGTAGCTGGTAGGGG - Intronic
960729522 3:120710807-120710829 AGTGGCATGGTAGCTGGAAGAGG - Intronic
961581675 3:127888333-127888355 GGTTCCATGGTTCCTGGAAGGGG + Intergenic
962966808 3:140363558-140363580 GGTACCATGGCAGCTGACAGTGG + Intronic
963509373 3:146227849-146227871 GATATCATGGTAGCTGGTGTAGG - Intronic
964363280 3:155921126-155921148 GGTACACTGGTGGCTGCTAGGGG + Intronic
969324131 4:6431229-6431251 TATACCATGGAAGCTGGCAGGGG - Intronic
974610081 4:64205894-64205916 GGCACCATGGTAGCATCTAGGGG + Intergenic
975897164 4:79106756-79106778 GGTAATTTGGTACCTGGTAGTGG + Intergenic
981611555 4:146598591-146598613 GGTAGAATGGTAGCTGGTAGGGG - Intergenic
982885632 4:160777213-160777235 GGAACCATGGTACCTGCCAGCGG + Intergenic
983103037 4:163649711-163649733 GGTATCATGGAAGGTGGTGGGGG - Intronic
984361674 4:178742661-178742683 GGTTGCATGGGAGCTGGGAGAGG - Intergenic
984617879 4:181919132-181919154 GGTACCATGATACCAGGCAGGGG + Intergenic
985758482 5:1733075-1733097 GGTCCCATGGCAGCTGGCTGGGG - Intergenic
987225898 5:15841503-15841525 GGTAACCTGGTAGCTTGCAGTGG + Intronic
988845430 5:35122844-35122866 GGTACCAGGGTGGCTGAGAGTGG + Intronic
992773864 5:80072998-80073020 GGTAGCATGGTGGCAGGTGGAGG - Intronic
1000827599 5:166065423-166065445 GGAACCATGGAAGGTTGTAGAGG - Intergenic
1001777226 5:174337798-174337820 GGAACCATGGTAGGGGGCAGGGG + Intergenic
1003054177 6:2804032-2804054 GGTACCATGTGAGCTGACAGGGG - Intergenic
1004753008 6:18583116-18583138 GGGACCATGGTGGCTGGATGTGG + Intergenic
1006956425 6:37877328-37877350 GTTTCCTTGGTAGCTGGTTGTGG + Intronic
1010889860 6:81293368-81293390 GGTACAATGGTGGCTGAGAGTGG + Intergenic
1012477777 6:99634078-99634100 GGTACCATTTTAGGTGTTAGTGG + Intergenic
1012808458 6:103926474-103926496 GCTATCATGGGAGGTGGTAGTGG + Intergenic
1013097991 6:106963301-106963323 AGTACCATGGTAACTGGGGGAGG - Intergenic
1020440818 7:8214939-8214961 GCTACCACGGAATCTGGTAGAGG + Intronic
1022665861 7:32409953-32409975 GGGACCAGGTTAACTGGTAGTGG - Intergenic
1022847778 7:34228154-34228176 GGTTCCATAGCAGCTGGAAGTGG - Intergenic
1023491082 7:40742652-40742674 GGTACCATGGTCCATGGTATGGG - Intronic
1025109137 7:56198286-56198308 AGTACCTCTGTAGCTGGTAGAGG - Intergenic
1026034224 7:66819498-66819520 GGTGCCCTTGTAGCTGGTACGGG - Intergenic
1028779588 7:94720229-94720251 GATACCTTGGTTGCTGGTACAGG + Intergenic
1032436057 7:131901136-131901158 GGTAACATGGGAACTGGGAGAGG + Intergenic
1035992519 8:4508669-4508691 GATAACAAGGCAGCTGGTAGTGG + Intronic
1036011910 8:4735306-4735328 GGTAACTTGGTAGCTGGCATTGG - Intronic
1038042214 8:23733603-23733625 GGTACTATGGTGGCTGAAAGAGG - Intergenic
1044106947 8:88221119-88221141 GGTACCAAAATAGCTGGGAGGGG + Intronic
1047704921 8:127488648-127488670 GGTACCACTCTGGCTGGTAGTGG + Intergenic
1050311617 9:4359009-4359031 AGGACCATGGTGGCTTGTAGAGG + Intergenic
1053688711 9:40568733-40568755 GGCACAATGGCAGCTGGGAGGGG - Intergenic
1054299951 9:63369644-63369666 GGCACAATGGCAGCTGGGAGGGG - Intergenic
1187467795 X:19542135-19542157 GGGACCATGGCAGCAGGTGGCGG - Exonic
1192630594 X:72774939-72774961 GGTACCCTGTTAGCTAATAGCGG - Intergenic
1192651116 X:72945865-72945887 GGTACCCTGTTAGCTAATAGCGG + Intergenic
1195094135 X:101489712-101489734 GGTGCCAGGGTTGATGGTAGGGG + Exonic
1195801051 X:108710990-108711012 GGTAGAATGGTGGCTGCTAGGGG - Intergenic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic