ID: 1170704509

View in Genome Browser
Species Human (GRCh38)
Location 20:18733176-18733198
Sequence CTCAGTGGGCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170704498_1170704509 21 Left 1170704498 20:18733132-18733154 CCCAGGTGTCCTCAGGGGGACTG 0: 1
1: 1
2: 0
3: 12
4: 209
Right 1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 58
4: 600
1170704499_1170704509 20 Left 1170704499 20:18733133-18733155 CCAGGTGTCCTCAGGGGGACTGT 0: 1
1: 0
2: 2
3: 13
4: 169
Right 1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 58
4: 600
1170704502_1170704509 12 Left 1170704502 20:18733141-18733163 CCTCAGGGGGACTGTGTGGGACA 0: 1
1: 1
2: 1
3: 16
4: 200
Right 1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 58
4: 600
1170704496_1170704509 25 Left 1170704496 20:18733128-18733150 CCATCCCAGGTGTCCTCAGGGGG 0: 1
1: 0
2: 1
3: 35
4: 345
Right 1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 58
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170704509 Original CRISPR CTCAGTGGGCAGAAGGAGGG TGG Intronic
900354414 1:2253339-2253361 CACAGCGGGCAAAAGGTGGGAGG + Intronic
900412820 1:2520602-2520624 CCCAGTGGGCGGGAGGGGGGTGG - Intronic
900734917 1:4293447-4293469 CTCAGGGGGCAGTAAGAGGGAGG - Intergenic
901004383 1:6164829-6164851 CTCAGTAGAGAGAAGGAGAGAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901632416 1:10654373-10654395 CTTCGTGGGCAGAAGCGGGGAGG - Intronic
901685406 1:10940903-10940925 CCCCGTGGGGAGAAGGTGGGTGG - Intergenic
902203766 1:14852521-14852543 GACAGTGGGAAGAAGCAGGGAGG - Intronic
902398589 1:16145383-16145405 TTAAGTGGGCAGAGGAAGGGAGG - Intronic
902648713 1:17822740-17822762 CTGAGTGGGCAGGAGGGGTGGGG + Intronic
903027230 1:20438125-20438147 CTTGGTGGGCAGGAGGTGGGAGG - Intergenic
903539354 1:24088103-24088125 GTCTCTGGGCAGATGGAGGGTGG + Intronic
903648493 1:24909128-24909150 CTCAGCAGGCCGCAGGAGGGTGG - Intronic
904490291 1:30854488-30854510 CTCAGGAGGTAGAAAGAGGGAGG - Intergenic
904939513 1:34155641-34155663 CTCAGGGGTGAGAAGGAGGGTGG - Intronic
905726079 1:40253094-40253116 CTCAGGGGGCTGAAGCAGGAGGG + Intergenic
905791828 1:40793757-40793779 TGCAGTGGGCAGAAGAGGGGAGG - Intronic
906096570 1:43228208-43228230 GTCAGTGGGCTGGAGCAGGGAGG - Intronic
906240380 1:44239002-44239024 AGCAGTGGGGAGAGGGAGGGTGG - Intronic
906511260 1:46411593-46411615 CGAACTGGGCAGAAGGAGTGTGG - Exonic
907701390 1:56791627-56791649 TTCAGTGTGTAGAATGAGGGAGG + Intronic
907966013 1:59330603-59330625 TCCAGTGGGTAGAAGTAGGGAGG - Intronic
908896688 1:68909188-68909210 CTCAGGAGGCTGAAGGTGGGTGG + Intergenic
909532052 1:76692587-76692609 CTCTGGGGGCTGAAGGATGGTGG + Intergenic
909690550 1:78402529-78402551 GTCAGTGGGCTGAAGAAGGAAGG - Intronic
910368721 1:86493519-86493541 CCCAGTGGACAGAAGCAAGGTGG + Exonic
910369300 1:86498902-86498924 CTTAGGGGGCAGAAGGCAGGAGG + Intronic
910864102 1:91771906-91771928 ATCTGTGGGCAGCAGGAAGGGGG + Intronic
910939215 1:92515067-92515089 CTTAGTGGGGAGGAGGAGAGAGG + Intronic
913257037 1:116963108-116963130 CTCTGTGGGCACAGGTAGGGAGG - Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914400593 1:147316580-147316602 CTCCCTGGGCAGGAGAAGGGCGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915823778 1:159054478-159054500 TTCATTGGGCAGAAGGAAGGGGG - Intronic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
916276079 1:162994749-162994771 TTCAGAGGGTAGAAGGTGGGAGG + Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916445862 1:164871275-164871297 TTCAGTGGGCAGAGGGACTGAGG + Intronic
916472402 1:165137220-165137242 CTGAGTGCCCAGAATGAGGGAGG + Intergenic
916472423 1:165137274-165137296 CTCTGTGGGCAGGTGGTGGGAGG + Intergenic
916816978 1:168363676-168363698 CTCACATGGCAGAAGGTGGGAGG - Intergenic
917495088 1:175533315-175533337 CTCAGTGTGCAGCAGAAGGAAGG + Intronic
917613884 1:176717095-176717117 CTCAGGGGGCTGCAGAAGGGTGG - Intronic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
917972143 1:180215419-180215441 CTCAGGGGGCTGAGGGTGGGAGG + Intergenic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918613554 1:186518679-186518701 CTCAGGGGGCATAATGAGAGAGG - Intergenic
919712050 1:200738797-200738819 CTCAGTGGGCCGGAGACGGGAGG + Intergenic
920250212 1:204618217-204618239 CTCCGTGGCCTGAAGGAGGCGGG + Exonic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922556179 1:226534023-226534045 CTCAGTGGGAAGATGGGAGGAGG + Intergenic
923194948 1:231656776-231656798 ATCAGTGGGCAGTGGGTGGGAGG - Intronic
923288024 1:232515694-232515716 CTTTGTGGGCAGAAGCAGAGGGG - Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
924656567 1:245977985-245978007 CTCTGTGGCCTGATGGAGGGAGG - Intronic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063436601 10:6037052-6037074 CCCAGGGGGCAGATGGAGAGGGG - Intronic
1064116985 10:12586660-12586682 GTGAGGGGGCAGCAGGAGGGTGG - Intronic
1064251272 10:13708167-13708189 CTCAGTGGCCAGAGAAAGGGGGG - Intronic
1065627834 10:27649639-27649661 CTCAGTGAGCAAGAGGAGAGTGG - Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1067469702 10:46527607-46527629 CTCGGTGGGCAGCAGGGAGGAGG + Intergenic
1068054185 10:51990714-51990736 CTCAGAGGGTAGAGGGTGGGAGG - Intronic
1068743591 10:60502682-60502704 CCCTGTAGGAAGAAGGAGGGAGG + Intronic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1070618517 10:77988133-77988155 CTCAGTGGGAAGAAAGAGAGTGG - Intronic
1070820094 10:79349366-79349388 CTCACTGGGCACCAGGAGTGGGG - Intronic
1071312946 10:84361037-84361059 TTCAGAGGACAGAAGGAGGCAGG + Intronic
1071367694 10:84916667-84916689 CTCAGAGGACAGAAAGAAGGAGG - Intergenic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072278093 10:93842275-93842297 GTCAGGAGGCAGAGGGAGGGAGG - Intergenic
1072576062 10:96701285-96701307 CTCAGTGTGGAAGAGGAGGGTGG + Intronic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1072643224 10:97230271-97230293 CTCAGTGGTAAGTAGGGGGGAGG - Intronic
1072944721 10:99799414-99799436 CACAGTGGCAAAAAGGAGGGTGG - Intronic
1073059362 10:100724306-100724328 CGCAGTGGGCAGGAGGGAGGAGG - Intergenic
1073094726 10:100972666-100972688 CTAAGAGGTCAGAAGGAGGGAGG - Intronic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1074432066 10:113402772-113402794 CTCAGACGGCAGAGGGAGGAAGG + Intergenic
1074527925 10:114277854-114277876 ATGAGGGGGCAGGAGGAGGGTGG + Intronic
1075572382 10:123555756-123555778 CTCAGTGGGCAGGTGGAATGGGG + Intergenic
1075723629 10:124600817-124600839 CCCAGTGGTCAGTAGGAAGGAGG + Intronic
1076250430 10:128980153-128980175 CTCAGAGTGCAGGAGGAAGGGGG - Intergenic
1076468579 10:130702857-130702879 CTTAGTGGCCAGAGGGAGAGGGG + Intergenic
1077161202 11:1113463-1113485 CTGAGTGGGCAGAAGGGGCGGGG - Intergenic
1077276205 11:1710266-1710288 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1077707362 11:4499840-4499862 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1077899708 11:6478644-6478666 CCCTGTGGGCTGCAGGAGGGAGG + Intronic
1078727515 11:13944856-13944878 GTTAGAGGGAAGAAGGAGGGAGG + Intergenic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1080711559 11:34752691-34752713 CTCATAGGGAAGAGGGAGGGTGG + Intergenic
1080783381 11:35451827-35451849 CTCATGTGGCAGAAGGAGGGTGG - Intronic
1081569096 11:44278593-44278615 CTCAGTGGGCAGCTGGAGGTGGG - Intronic
1081808509 11:45902657-45902679 CTCAGTGGGCGGCAGGAAGGCGG - Exonic
1082894144 11:58172235-58172257 CTCAGTGGGCACAGGGATGTTGG + Intronic
1083135853 11:60676403-60676425 CCCAGTGGGCTGAGGGAGTGGGG + Intergenic
1083858253 11:65404574-65404596 CTCCATGGGCAGAAGCAGGTGGG - Intronic
1083912321 11:65717426-65717448 CTCACTGGACACAAGGAGCGAGG - Intronic
1083962307 11:66021184-66021206 AGCTGTGGGCAGAAGGAGTGGGG + Exonic
1084495865 11:69502699-69502721 CTCAGTGGGCAGATGCAGCTGGG - Intergenic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085025314 11:73233036-73233058 CTCAGTGGGGACAAGGTTGGGGG + Intronic
1085043333 11:73339667-73339689 CAGATTGGGCAGAAGTAGGGAGG + Intronic
1085249822 11:75135543-75135565 CTCAGTGGGAAGAACCAGGTTGG + Intronic
1085477424 11:76796998-76797020 CGCAATGGGCAGAGGGTGGGTGG + Exonic
1085503501 11:77042264-77042286 ATCAGTGAGCAGCAGGCGGGTGG - Intergenic
1085534430 11:77209536-77209558 CTCAGTGGGCAGCATGGGGTGGG - Intronic
1086791404 11:91043206-91043228 CTCACAGGGCAGCAGGATGGAGG + Intergenic
1087978138 11:104575902-104575924 CTCAGAGGGGAGAAGGGGTGAGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089534224 11:119150631-119150653 CACAGTGCTCAGAAGCAGGGAGG + Intronic
1089693189 11:120199287-120199309 CACAGTGGGAAGAAGGAGTCCGG + Intergenic
1090442702 11:126737350-126737372 CACAGTGGGCAGGGAGAGGGCGG + Intronic
1091079000 11:132648607-132648629 CTCAGGAGGCTGAAGCAGGGAGG - Intronic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093480562 12:19600177-19600199 CTCAGGTGGCAGAAGGAGCAAGG - Intronic
1093641322 12:21529631-21529653 GTCACTGGGCAGGAGGTGGGGGG - Intronic
1093837111 12:23846113-23846135 CTCAGAAGGCAGAAGAAGGTGGG - Exonic
1094041555 12:26125267-26125289 TGCAGTCGGCAGGAGGAGGGGGG + Intronic
1094042810 12:26135183-26135205 CTCAGAGGCCAGAAGTAGGGAGG + Intronic
1094631015 12:32173949-32173971 CTCTGTGGGAAGAAGCAGAGTGG - Intronic
1096439295 12:51626057-51626079 GTCAGGAGGCAGAAGGAGCGAGG + Intronic
1096504359 12:52083173-52083195 CTCAGAGGCCAGAAGGCAGGGGG - Intergenic
1096693016 12:53332828-53332850 GTCAGGGGGGAGAAGAAGGGAGG - Intronic
1097416589 12:59323398-59323420 CTCAGTGGGCAGGAGTGGGGGGG + Intergenic
1100347681 12:93748413-93748435 CTCAGGAGGCTGAAGCAGGGGGG - Intronic
1100610092 12:96184697-96184719 CTCACACGGCAGAAGGAGTGAGG - Intergenic
1100762701 12:97826881-97826903 CTCATGTGGCAGAAGGAGAGAGG - Intergenic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1102281287 12:111620946-111620968 CTCAGTGGGGAGGATGATGGTGG - Intergenic
1102289205 12:111685487-111685509 CTCAGACGGCACAGGGAGGGAGG + Intronic
1102713944 12:114953331-114953353 CTTAGTGTGCAGAGGCAGGGAGG + Intergenic
1102721921 12:115023848-115023870 TGCAGTGGGGAAAAGGAGGGAGG + Intergenic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1103946747 12:124531475-124531497 GCCTGTGGGGAGAAGGAGGGAGG + Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1104167443 12:126247267-126247289 CTCAGTGGCTGGAAGGAGTGGGG + Intergenic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1105688444 13:22810401-22810423 ATCAGAGGGCAGAGGGTGGGAGG + Intergenic
1107360564 13:39613261-39613283 CTCACATGGCAGAAGGAGCGAGG + Intergenic
1107904109 13:45046542-45046564 TTCACTGGGCAGGGGGAGGGAGG - Intergenic
1108408031 13:50124385-50124407 TTGAGTGGGCAGAGGGAGAGAGG - Intronic
1108953490 13:56120075-56120097 CACAGTGGGTAGTAGGAAGGTGG - Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109985984 13:69985001-69985023 CTCAGGAGGCTGAAGCAGGGAGG + Intronic
1110714187 13:78683282-78683304 GTCAGGAGGCAGAAGAAGGGAGG + Intergenic
1110774587 13:79393695-79393717 CTCAGTGGTCATACGGGGGGAGG - Intronic
1111234839 13:85396500-85396522 ACCAGAGGGCAGAAGGTGGGAGG - Intergenic
1111445199 13:88338760-88338782 GTCAGAGGGCAGGAGGTGGGAGG - Intergenic
1111864416 13:93750980-93751002 ACCAGTGTGCAAAAGGAGGGAGG + Intronic
1112415066 13:99197334-99197356 TACTGTGGGCAGGAGGAGGGGGG + Intergenic
1112437324 13:99399682-99399704 CCCAGGGGGCAGTAGGAGAGGGG - Intergenic
1113790862 13:113027424-113027446 CTTGGTGGGCAGAAAGAAGGGGG + Intronic
1114495258 14:23127545-23127567 GTCAGTGGGCACAGGGAAGGTGG - Intronic
1115238576 14:31232397-31232419 ATAACTGGGGAGAAGGAGGGAGG - Intergenic
1115301846 14:31893667-31893689 CTCAGTGAGGAGGAGGCGGGAGG + Intergenic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1117922134 14:60735715-60735737 GGAAGGGGGCAGAAGGAGGGAGG + Intronic
1118167410 14:63350763-63350785 CTCAGGAGGCTGAAGCAGGGGGG + Intergenic
1118384284 14:65242786-65242808 CTTAGAGGGCAGGAGGAGGGAGG + Intergenic
1118808508 14:69257795-69257817 CTCCATGGGGGGAAGGAGGGAGG - Intergenic
1118867681 14:69716208-69716230 TTCAGTGGGCAGGAGCAGTGAGG + Intergenic
1119085128 14:71732405-71732427 CTCAGTAGGCAGAAGCTGGGTGG - Intronic
1119377405 14:74206015-74206037 CTCAGTGGGTGGAAGGATGGGGG - Intergenic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1120566721 14:86068762-86068784 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1120861227 14:89256588-89256610 CTCAGTGGGAAGAGGAAGGATGG - Intronic
1121125860 14:91406390-91406412 CTCACAGTGCAGGAGGAGGGAGG + Intronic
1121324717 14:93013130-93013152 CTCAGTGTGCAGAACCAGGCAGG - Intronic
1121333076 14:93060051-93060073 ACCAGAGGGCAGGAGGAGGGGGG + Intronic
1121650064 14:95551661-95551683 ATCAGAGGGCAGCTGGAGGGTGG - Intergenic
1121937684 14:98035280-98035302 CTCTGTGGGCAGAAGTGAGGGGG - Intergenic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1122202805 14:100132798-100132820 CTCAGTGGGGAGCCTGAGGGTGG - Intronic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1124682083 15:31740415-31740437 CTCAGTGAGCAGATGGTGGGGGG + Intronic
1124745961 15:32342556-32342578 CTCGCGGGGCAGGAGGAGGGCGG - Intergenic
1125040936 15:35186570-35186592 CTCAGCTGGTAGAAGCAGGGTGG - Intergenic
1125126385 15:36227060-36227082 ACCAGAGGGCAGAGGGAGGGAGG + Intergenic
1125679072 15:41519620-41519642 GACAAAGGGCAGAAGGAGGGAGG - Intronic
1125944835 15:43704414-43704436 CTGAGTTGGGAGCAGGAGGGAGG - Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1126508815 15:49441854-49441876 CTCAGTGGTCAGTAGGAGGAGGG + Intronic
1127920723 15:63492225-63492247 CACAGTGGCCAGAGAGAGGGAGG + Intergenic
1128346914 15:66859853-66859875 GTCACTGGGCAGCAGGAGAGGGG - Intergenic
1128613005 15:69088686-69088708 GTCAGTGGGCAGAATGGGGTGGG + Intergenic
1129673890 15:77622077-77622099 CTGATTGGGCAGCAGGAGAGAGG + Intronic
1129986523 15:79923740-79923762 CTCGGTGGGCGGAGGGACGGAGG - Exonic
1130056896 15:80533800-80533822 CACAGTGGGCAGAAGCCTGGGGG + Intronic
1130754120 15:86744685-86744707 CTCAGTGCAAAGAGGGAGGGTGG - Intronic
1131155024 15:90069553-90069575 CTCAGTGGTCAGAAGTACAGAGG + Intronic
1131545758 15:93314441-93314463 TTCAGGGGACAGAAGGAGGCTGG + Intergenic
1132149888 15:99451872-99451894 TTCCCTGGGCAGAAGGAGAGAGG - Intergenic
1132563576 16:610207-610229 CTCAGGGGACAGAGGCAGGGAGG - Intronic
1133723440 16:8516213-8516235 CCCATTGGCCAGAAGCAGGGAGG - Intergenic
1134619235 16:15675123-15675145 CTCAAGGGGCAGGAGGTGGGAGG + Intronic
1136118152 16:28108806-28108828 CTCAGGAGGCAGATGGAGGCAGG + Intronic
1136656444 16:31712092-31712114 CTGAGTGGGAAGTAAGAGGGTGG + Intergenic
1137030847 16:35522825-35522847 GACAGTGGGCCCAAGGAGGGGGG - Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1138626973 16:58260162-58260184 ATCAGTGGGAAGCAGGAGGGTGG + Intronic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1141232820 16:82186257-82186279 CTCAGTGAGCACAAGGAATGAGG + Intergenic
1141309047 16:82895333-82895355 CTAAGTGTGATGAAGGAGGGAGG - Intronic
1141462798 16:84187707-84187729 CTCGGGGGGCAGAGGTAGGGTGG - Intergenic
1141496539 16:84414344-84414366 CCCAGTGGGCACAAGGTGGCAGG - Intronic
1141553190 16:84819836-84819858 CTCAGCGGGCTGAAGGAGGCGGG - Intergenic
1141761727 16:86033169-86033191 CTCAGGTGGCAGCGGGAGGGAGG - Intergenic
1141931282 16:87205277-87205299 CTCAGGGGGCTGAAGCAGGAGGG + Intronic
1142071315 16:88092455-88092477 ATCAGAGGGAAGAGGGAGGGAGG + Intronic
1142135602 16:88450628-88450650 CACAATGGGCAGCAGGTGGGGGG + Intergenic
1142198218 16:88748537-88748559 CACAGCGGGCAGCGGGAGGGCGG + Intronic
1142304577 16:89278302-89278324 CCCAGTGGGTAGGAGGAGGTGGG + Intronic
1142351520 16:89582963-89582985 CTCAGTGAGGAGCAGGACGGGGG - Intronic
1142702657 17:1673557-1673579 CTCTGTGGGCAGAGGCCGGGCGG - Exonic
1142742715 17:1940523-1940545 CTCCTTGGGCAGATGGAGGCAGG - Intronic
1143253254 17:5537908-5537930 CTCAGTGGGGAGCAGCAGGCTGG + Intronic
1143542949 17:7580380-7580402 CTCAGAGGGAAGAAGGAAGAGGG + Intronic
1143724389 17:8835455-8835477 CTCTGAGGGCAGAAGCAGAGGGG + Exonic
1143861815 17:9896908-9896930 CTGAGGGGGCAGGAGGAGAGAGG - Exonic
1144202893 17:12957064-12957086 CTCAGTGGGTAGAGGGGGTGAGG - Intronic
1144228606 17:13176355-13176377 CTGAGTGGCCACAATGAGGGTGG - Intergenic
1144702678 17:17349259-17349281 CTCCCTGGGCAGGAGGAGGGAGG - Intergenic
1144769099 17:17749314-17749336 CTCAGGAGGCAGGAGCAGGGAGG - Intronic
1144950585 17:18991562-18991584 CACACTGGGCAGGAGGCGGGTGG + Intronic
1145228805 17:21155037-21155059 CACAGTGGGCAGAAGAACTGTGG + Intronic
1146268894 17:31471737-31471759 CCCACTGGGCAGCAGCAGGGTGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147969954 17:44213914-44213936 ATGAGTGGGCTGAGGGAGGGAGG - Intronic
1148082601 17:44975949-44975971 CTCAGTGGGCTGAACTAGGCTGG + Intergenic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1148598723 17:48878004-48878026 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1148681152 17:49474208-49474230 CGCAGTGGGGAGAAGGGGAGGGG - Intronic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151491489 17:74434266-74434288 CTCAGAGGGTTCAAGGAGGGGGG - Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152032353 17:77851776-77851798 GACAGTGGGCAGGAGGATGGCGG - Intergenic
1152456124 17:80417212-80417234 CACAGTGGGCTGTAGGAGGTGGG - Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1153162003 18:2216910-2216932 GTCACAGGGCAGAAGGTGGGAGG + Intergenic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1154383114 18:13870146-13870168 CTCAGTGGGCACAAGGCTGCTGG + Intergenic
1155247166 18:23921766-23921788 GGCAGTGGAAAGAAGGAGGGTGG + Intronic
1155346743 18:24864955-24864977 CTCAGTTGGCAGTAGAAGTGAGG - Intergenic
1155555900 18:27019112-27019134 CTCATTTGGCAAAGGGAGGGAGG - Intronic
1156084482 18:33382533-33382555 GACAGTGAGCAGAAGCAGGGTGG + Intronic
1156179348 18:34584801-34584823 TTCAGAGAGAAGAAGGAGGGAGG + Intronic
1156553602 18:38043445-38043467 CTCAAAGGGGAGAGGGAGGGAGG + Intergenic
1156778454 18:40821886-40821908 CTCCCTGGGCAGGAGAAGGGTGG + Intergenic
1157308369 18:46533591-46533613 TTCAGTGGGTAAGAGGAGGGGGG + Intronic
1157529388 18:48408994-48409016 CGCGGTGGGCAGGAGGCGGGGGG - Intronic
1157813066 18:50711372-50711394 CCCAGTGGGCACAAGGTGGCAGG + Intronic
1157958260 18:52123497-52123519 GTCAGGGGGCATAAGGAGAGAGG + Intergenic
1158623390 18:59051424-59051446 CTCAGTGGGCACGTGGCGGGTGG - Intergenic
1158684474 18:59600705-59600727 CCCAGTGGGCAGGAGGAGATGGG - Intronic
1158850929 18:61495511-61495533 CCCAGGAGGCAGGAGGAGGGAGG + Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160310817 18:77788460-77788482 CCCAGTGGGCAGGAGGGGAGAGG + Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1161681095 19:5680247-5680269 CTCGCTGGGAAGCAGGAGGGAGG + Intronic
1161865923 19:6832216-6832238 CTCTGTGGACAGAAAGAGGGAGG - Intronic
1162062843 19:8107263-8107285 ATAAATGGACAGAAGGAGGGGGG + Intronic
1162805416 19:13135766-13135788 GACAGTGGCCAGAAGGAGGCTGG + Exonic
1162876409 19:13624013-13624035 CCCAGTGGAAAGAAGAAGGGTGG + Intergenic
1163154710 19:15433369-15433391 CTAAGTGGGCAGGAGGGGGCGGG - Intronic
1163327351 19:16613617-16613639 CTCTGAGGGCAGAAGGAGTCGGG + Intronic
1163381275 19:16970624-16970646 CTCATATGGCAGAAGGAGTGAGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1164559209 19:29277083-29277105 CACAGGGGGAAGAGGGAGGGAGG + Intergenic
1165447554 19:35864850-35864872 CCCAGGGGGCAGGAGGAGTGGGG - Intronic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165686748 19:37828565-37828587 GTCAGTGGTCAGAAGGAAAGGGG + Intergenic
1165944908 19:39436128-39436150 CTCTGTGGGCGGAAGGGGCGGGG + Intergenic
1166099363 19:40562064-40562086 CACTGTGGCCAGATGGAGGGAGG + Intronic
1166288895 19:41849145-41849167 ATGAGTGGGCAGCTGGAGGGAGG - Exonic
1167244240 19:48364270-48364292 CTGAGTAGGCGGAAAGAGGGAGG + Intergenic
1167852978 19:52215983-52216005 CTCTGTGGGCAGGGAGAGGGAGG - Exonic
1168293554 19:55368653-55368675 CTCAGGTGGCAGAGTGAGGGAGG - Intronic
925001340 2:405219-405241 CTCAGATGGCAGCAGGAGAGAGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926090866 2:10048378-10048400 CACAGGGGGCAGGCGGAGGGAGG - Exonic
926707250 2:15845588-15845610 CTCAGAGGGCACAATGAGAGGGG - Intergenic
927108607 2:19848342-19848364 TTCATTGGGCAGAAGGAAGTCGG + Intergenic
927377616 2:22436600-22436622 CTGAGGGGGCAGAAGGGAGGTGG - Intergenic
928079900 2:28301629-28301651 TTGAGGGGGCAGAAAGAGGGTGG - Intronic
928130962 2:28649704-28649726 CTCTGTGGGCAGAAAAAGGGAGG + Intergenic
929576213 2:43054503-43054525 CTCAGCCGGCGGAAGGAGGGTGG - Intergenic
929766516 2:44848277-44848299 CTGGGTGGGCTCAAGGAGGGAGG + Intergenic
929801521 2:45108507-45108529 TTCAGTGGTCAGAAAGAGGAGGG + Intergenic
931011244 2:57916525-57916547 ATCATTGGGCTTAAGGAGGGTGG - Intronic
932300587 2:70664231-70664253 CCCAGTAGGCAGAGGGAGAGTGG + Intronic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932409266 2:71535533-71535555 CTCTGAGGGCAGAAGGAGCTGGG + Intronic
932432654 2:71685174-71685196 CGCTGTGGGCAGAAGCAGAGTGG + Intronic
932457273 2:71857723-71857745 CACAGTGGGCTGCTGGAGGGTGG - Intergenic
932748633 2:74356516-74356538 CTCAGTGGGGAGCAGGGGTGGGG - Intronic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
934579504 2:95427246-95427268 CTCCGTGGGCTGAAAGAAGGAGG - Intergenic
934599940 2:95649478-95649500 CTCCGTGGGCTGAATGAAGGAGG + Intergenic
934694932 2:96392958-96392980 CTCAGTGGACAGGAGGGGAGAGG - Intergenic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
935037327 2:99391274-99391296 CTGAGAGGGAAGAAGGAGAGGGG + Intronic
935079179 2:99775551-99775573 GTCAGAGGGCAGGAGGAGGTAGG + Intronic
935185010 2:100723936-100723958 CTAAGAGGGCAGAAGCAGGCAGG - Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
936119215 2:109726849-109726871 CCCAGTGGACAGAGGCAGGGAGG + Intergenic
936147278 2:109988308-109988330 CTCAATGGGCAGAAGCTGGGTGG - Intergenic
936197414 2:110383175-110383197 CTCAATGGGCAGAAGCTGGGTGG + Intergenic
936642495 2:114330571-114330593 CCCTGTGGGCTGAAGGAGGATGG + Intergenic
936659796 2:114529836-114529858 ATCAGAGGACAGAGGGAGGGAGG - Intronic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
937299454 2:120830286-120830308 CTCAGAGGGCAGAGGGAGCTAGG - Intronic
937872993 2:126799066-126799088 TTCAGTGGGCAGAAGGGGGCAGG - Intergenic
938236500 2:129710396-129710418 GCCAGAGGGCAGAGGGAGGGAGG + Intergenic
939271866 2:139949425-139949447 ATCAGTGGGCAGAAGGGAGGAGG + Intergenic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
942959341 2:181811337-181811359 TTATGTGGGCAGGAGGAGGGGGG + Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
943836319 2:192518132-192518154 CTCTGGTGGCAGAAGAAGGGGGG - Intergenic
946202809 2:218080766-218080788 CCAAGTGGGCAGCAGGTGGGAGG - Intronic
946410741 2:219514033-219514055 CTCAGAGGCCAGGAGGTGGGGGG + Intergenic
948011407 2:234652045-234652067 CTCAGTGGGCAGTGGGGGGTGGG + Intergenic
948211481 2:236196435-236196457 CTCAGTGGGGAAAGGGTGGGGGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948929386 2:241122392-241122414 CTCAGTGGGGAGTAGGAGAATGG + Intronic
948938279 2:241182552-241182574 CTGAGTGGGAAGGAGGAGGGTGG + Intronic
1168809490 20:695086-695108 CTCAGTGGGGAGAGGGTGCGTGG - Intergenic
1168829808 20:839681-839703 CTCCGGGGGCAGATGTAGGGTGG + Intronic
1168903830 20:1388722-1388744 CACAGTAGCCAGAAGGAGCGTGG + Intronic
1169320747 20:4631487-4631509 TTCAGTGGCCAGAAGTAGGGAGG + Intergenic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170005233 20:11661507-11661529 GTCAGAGGGCAGAGGGTGGGAGG - Intergenic
1170058875 20:12238599-12238621 ATCAGAGGGCGGAAGGTGGGAGG + Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1171013904 20:21523010-21523032 CTCAGAGGGGCGCAGGAGGGAGG - Intergenic
1171482197 20:25462378-25462400 CGCAGTGGGCAGCAGCAGGTGGG - Exonic
1171791799 20:29533317-29533339 CTCAGACGGCGGAAGGCGGGAGG - Intergenic
1173337538 20:42124962-42124984 CTCAGAGGCCAGGAGGAGGTTGG + Intronic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1173905553 20:46626181-46626203 GGGAGTGGGAAGAAGGAGGGAGG - Intronic
1173916558 20:46712413-46712435 GTCAGGGGGCAGGGGGAGGGGGG - Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174580950 20:51571066-51571088 CTCTGTGGGTAGAAGAAGCGGGG + Intergenic
1175129479 20:56778819-56778841 CACAGTGGGCTGGAGCAGGGGGG - Intergenic
1175215063 20:57388003-57388025 CTCACTGGGGAGCGGGAGGGAGG - Intergenic
1175419635 20:58823146-58823168 CTCAGTTGGCAGCAGGATGGAGG - Intergenic
1175618338 20:60422500-60422522 CTCTGTGGGGAGCTGGAGGGTGG - Intergenic
1176073250 20:63237510-63237532 CCCAGTGAGAAGAAGAAGGGAGG - Intronic
1176214047 20:63939927-63939949 GTCAGGAGGCAGGAGGAGGGTGG + Exonic
1176365699 21:6031587-6031609 CTCAGCCTGCAGAAGGAGTGGGG + Intergenic
1176377360 21:6093123-6093145 CTCAGTGGGGAGCAGGAGATGGG + Intergenic
1176424163 21:6537725-6537747 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1176674051 21:9760642-9760664 CTTAGTAGGAGGAAGGAGGGGGG - Intergenic
1179136565 21:38684879-38684901 CTCACTTGGCAGAAAGATGGTGG + Intergenic
1179699656 21:43146040-43146062 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1179746114 21:43445121-43445143 CTCAGTGGGGAGCAGGAGATGGG - Intergenic
1179757817 21:43506958-43506980 CTCAGCCTGCAGAAGGAGTGGGG - Intergenic
1179822073 21:43942796-43942818 CTCACTTGGCGGGAGGAGGGTGG + Intronic
1179902667 21:44402073-44402095 CGCAGGGGGCATGAGGAGGGAGG - Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180645798 22:17337731-17337753 CTCAGAAGGCAGGAGGAGAGAGG + Intergenic
1181055056 22:20256904-20256926 GGCAGTGGGCAGAAGGTGGAGGG - Intronic
1181485554 22:23229576-23229598 CTCAGTGGTCAACAGCAGGGTGG - Intronic
1181897378 22:26122374-26122396 ATCATTGTGGAGAAGGAGGGAGG - Intergenic
1181945677 22:26515605-26515627 CTCCTTGGGCAGAAGGAGTCTGG + Intergenic
1182119041 22:27775055-27775077 CCCAGTGGGCAGAAAGAATGGGG + Intronic
1182796881 22:32997417-32997439 AGCAGTGGTCAGCAGGAGGGTGG + Intronic
1182831263 22:33306406-33306428 GGAAGTGGGCGGAAGGAGGGAGG + Intronic
1183012394 22:34957590-34957612 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1183079345 22:35446659-35446681 CGCAGTGGGAGGAAGGAGTGAGG + Intergenic
1183189511 22:36312677-36312699 CTCAGTGTGCAGAAGGCTGCTGG - Intronic
1183310962 22:37109331-37109353 ATCAGTGAGCAGAAGGTGAGGGG - Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184691321 22:46118616-46118638 CTGAGCGGGAGGAAGGAGGGTGG - Intergenic
1184955567 22:47883865-47883887 CACAGTGGGCAGAAGCTGGGAGG + Intergenic
1185044936 22:48524023-48524045 GTCAGAGGGCGGAAGCAGGGTGG + Intronic
1185132832 22:49049693-49049715 CTAAGTGCTGAGAAGGAGGGAGG + Intergenic
949632966 3:5949130-5949152 TTCAGTGGGGACTAGGAGGGAGG + Intergenic
950083277 3:10238929-10238951 CTCTGTGGGGAGAAGTGGGGTGG - Exonic
950815080 3:15692339-15692361 CTCAGAAGGCTGAGGGAGGGAGG + Intronic
951913763 3:27777926-27777948 GTCAGGAAGCAGAAGGAGGGAGG + Intergenic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
952577648 3:34794406-34794428 CTCAGTTGGCAGAAGGAGGTGGG - Intergenic
953885538 3:46712667-46712689 GTCCGTGGGGAGATGGAGGGTGG - Intronic
954197646 3:49006043-49006065 CTCTGTGGGCAGCAGGGTGGTGG - Exonic
955286871 3:57650131-57650153 CTCAGTGGGGAAAGGGAGGGAGG + Intronic
955466596 3:59243419-59243441 CTCACAAGGCAGAAGGAGTGAGG - Intergenic
956863249 3:73345425-73345447 CACAGTGGGCAGAAGGAACAGGG + Intergenic
960024303 3:112990839-112990861 TTCAGTGCGCGGGAGGAGGGTGG - Intergenic
960230731 3:115223612-115223634 CTCAGTAGGCTGAAGTGGGGGGG - Intergenic
960350912 3:116591560-116591582 GTCAGTGAGCAGGAGGAGAGGGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
961549665 3:127661813-127661835 GTCGGTGGGGAGGAGGAGGGTGG - Intronic
961771728 3:129254964-129254986 CTCTGTGGGCAAAAGGAGCAGGG - Exonic
962038194 3:131676528-131676550 ATCAGAGGGCAGAAGGTGGTAGG - Intronic
962278722 3:134034535-134034557 TTCAGGGGGCAGAAGGAGCGGGG - Intronic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963533024 3:146495571-146495593 CTCACAGGGCAGAAGCGGGGAGG - Intronic
963602734 3:147391914-147391936 CTCAGGGGGTAGAAGGAAAGAGG - Intronic
963893880 3:150664970-150664992 CTAAGTGGGGAGAGGAAGGGAGG + Intronic
965001992 3:162966163-162966185 GACAGTGAGCAGAAGCAGGGTGG + Intergenic
965384006 3:168024192-168024214 CTCAATGTGCAGAGGGAGAGAGG + Intronic
965484727 3:169264820-169264842 GTCAGTTGGCAGGATGAGGGTGG - Intronic
966819489 3:183913778-183913800 CTCAGTGAGCAGGTGGAGGTGGG + Intergenic
966980456 3:185129220-185129242 TTTAGAGGGCAGACGGAGGGGGG - Intronic
967036466 3:185651970-185651992 CTTGGTGGGCAGCAGCAGGGAGG + Intronic
967234938 3:187374881-187374903 CCCAGAGGGCAGAGGGTGGGAGG - Intergenic
967759375 3:193206203-193206225 GTCAGGAGGCAGACGGAGGGAGG + Intergenic
968095816 3:195929754-195929776 CTCACATGGCAGAGGGAGGGAGG - Intergenic
968448044 4:662331-662353 CTCCCAGGGCAGAAGGATGGAGG + Intronic
968497255 4:925706-925728 CTCACAGGGCAGAAGGGGTGAGG - Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968771730 4:2511805-2511827 CTCTGTGGGTGGGAGGAGGGTGG + Intronic
969349787 4:6591748-6591770 CTCAGTGGGGACCAGGAGTGTGG + Intronic
969494003 4:7515507-7515529 CTCAGCGGGCAGCCGGATGGAGG + Intronic
969849881 4:9947872-9947894 GTCAGGAGGCAGAAAGAGGGAGG - Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
970648854 4:18155829-18155851 CTGAGTGGGCATTAGAAGGGAGG - Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
972617527 4:40714528-40714550 GTCAGTGAGCATAAGGTGGGAGG + Intergenic
973783322 4:54311426-54311448 CTAAGTAGGCAGAAGGAAAGAGG - Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974162936 4:58163373-58163395 CTCAGTGGGGTGAAGGAGCTGGG + Intergenic
974377080 4:61092675-61092697 CTCAGAAGCCAGAAGGAGGGTGG + Intergenic
976025749 4:80686318-80686340 CTTAGAGAGCAGAAGAAGGGAGG + Intronic
976116533 4:81734048-81734070 CTCAGAGGGCAGAAAGAGCATGG + Intronic
976413067 4:84739511-84739533 CCCAGAGGGAAGAAGGAGTGTGG - Intronic
976461763 4:85320348-85320370 CTCTGTGGGCACATGGTGGGAGG + Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976666224 4:87595597-87595619 CTCAGTGGGAAGACTGAGAGGGG - Intergenic
976667485 4:87612434-87612456 CTAAGTGGGCAGAAGTAGGAGGG + Exonic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
978772489 4:112471414-112471436 CTCAGAAGGCAGAAGGCAGGGGG + Intergenic
980086244 4:128393209-128393231 CTAAGTGGGGAGGGGGAGGGAGG + Intergenic
980811049 4:137880970-137880992 CTCAATGGGCAGCAGGGAGGGGG + Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981657645 4:147130250-147130272 CTCAGTAGTCAGAAAGAGAGAGG + Intergenic
982668175 4:158291598-158291620 CTCAGTGGGGAGGAGCAGGCAGG - Intergenic
983076582 4:163333150-163333172 CTCAGTGGGCCAAAGAAAGGAGG - Intronic
983472804 4:168177133-168177155 GCCAGTGGGGAGAAGGAGGTAGG - Intronic
983915964 4:173290978-173291000 ATCAAGGGGCTGAAGGAGGGAGG - Intronic
984740965 4:183162725-183162747 CTCTGTGGGAAGAAGGAATGGGG - Intronic
984887021 4:184458112-184458134 CTGACTGGCCGGAAGGAGGGAGG - Intronic
985100606 4:186454488-186454510 CTCCCTGGGGAGTAGGAGGGTGG + Intronic
985843485 5:2327154-2327176 TTCAGTCAGCAGCAGGAGGGTGG + Intergenic
986296671 5:6445079-6445101 CTGAGATGGAAGAAGGAGGGGGG + Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986493369 5:8316889-8316911 CTTGGTGGGCAGGAGGATGGGGG + Intergenic
987033110 5:13993980-13994002 CTCAGAGGTCGGAAGGAGGAAGG + Intergenic
989181056 5:38577520-38577542 GTCAGTGGGCAGGAAGAGGAGGG - Intronic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
990470654 5:56112197-56112219 TTCAATGAGCAGAAGGATGGAGG + Intronic
991557545 5:67912524-67912546 ATCAGGAGGAAGAAGGAGGGAGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991964858 5:72080697-72080719 ATCAGAGGGTAGAAGGTGGGAGG + Intergenic
992160854 5:73999941-73999963 CTCAGTAGGCAGTATGAGGAGGG + Intergenic
992222209 5:74584258-74584280 CTCAGTGGGCAGATGGCAGTGGG - Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992623447 5:78616035-78616057 AACAGAGGGCAGAAGGAAGGAGG - Intronic
992749518 5:79849506-79849528 CTCAGTGGGCATGAGTAAGGAGG + Intergenic
992877240 5:81068954-81068976 ATCCCTGGGCAGAAAGAGGGAGG - Intronic
993095028 5:83471666-83471688 CTCAGCGAGAAGAAGGAGGAGGG - Exonic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
994593833 5:101806656-101806678 CTCAGTGGGCACCAGGAGTGGGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
996810107 5:127506947-127506969 CTCAGGTGGGAGCAGGAGGGTGG + Intergenic
997016768 5:129945236-129945258 CTCTGTGGGCAGGAGGAATGTGG + Intronic
997707603 5:135972943-135972965 CTCGGTAGGTAGAAAGAGGGAGG - Intergenic
998630065 5:143888356-143888378 CTCAGAGTGAAGAAGGAGGAGGG + Intergenic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
1000408709 5:160916053-160916075 CTCAGTGGGAACATGGAGGAGGG - Intergenic
1000898266 5:166882439-166882461 TTCAGTGTGGAGAAGGAGGGAGG + Intergenic
1001667433 5:173444890-173444912 CTCATATGGCAGCAGGAGGGTGG - Intergenic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1002169185 5:177366013-177366035 CTGAGTGGGAGGGAGGAGGGAGG + Intronic
1002210620 5:177596813-177596835 CCCAGAGGCCAGAGGGAGGGGGG - Intergenic
1002926303 6:1607677-1607699 TTCACTGGGCCGATGGAGGGAGG + Intergenic
1003221746 6:4166471-4166493 GTCAGAAGGCAGAGGGAGGGGGG + Intergenic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1005654287 6:27917674-27917696 CCCAGTGGGAAGAGAGAGGGAGG + Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1007390066 6:41545862-41545884 CGCAGTGGGGAGCAGGAGGGAGG + Intergenic
1007597498 6:43060394-43060416 ACCTGTGGGCAGAGGGAGGGAGG + Intronic
1007725583 6:43913830-43913852 GGCAGTGGGCAGCTGGAGGGAGG + Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1012166167 6:95955211-95955233 CTCAGAGGGTGGAAGGTGGGAGG + Intergenic
1012359457 6:98359361-98359383 TTCAGAGGGCAGAGGGTGGGAGG - Intergenic
1012431535 6:99168953-99168975 CTCAGTAGGAAGAACAAGGGTGG + Intergenic
1012525297 6:100170056-100170078 CTCAGTGGGGAGAAGGTGTTTGG + Intergenic
1013164184 6:107575018-107575040 CACAGTGGGCAGAAGCAGCATGG - Intronic
1015155733 6:130093794-130093816 ATCAGTGGTCAGAATGAGGGAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015715937 6:136191882-136191904 CCCAGAGGGCAGAAGCAGCGTGG + Exonic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1016285224 6:142464841-142464863 CTCAAAGGGCAGAAGGAGTCAGG + Intergenic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1017709383 6:157153363-157153385 ATCAGTGTGTAGAAGGAGGAGGG - Intronic
1017824486 6:158071406-158071428 AGCGGTGGGCAGCAGGAGGGAGG + Intronic
1017837048 6:158188018-158188040 GTCAGTTGGCAGATGGGGGGTGG + Intronic
1018923010 6:168188793-168188815 CTCAGTGGGAGGATGGAGGATGG + Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019193943 6:170270417-170270439 TTCAGTGGGCACTGGGAGGGAGG - Intergenic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024527254 7:50359406-50359428 CTCTGTGGGCAGAAGGCTGCAGG - Intronic
1024568216 7:50702040-50702062 CTCAGTGGGGAGGGGGAGGCAGG - Intronic
1025079126 7:55966931-55966953 GGCAGTGGCCAGGAGGAGGGAGG + Intronic
1025605788 7:63039013-63039035 CCCAGGAGGCAGCAGGAGGGGGG + Intergenic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1027978249 7:85185824-85185846 CTCGTTGGGCAGAAGCCGGGAGG + Intronic
1029439399 7:100578705-100578727 CTCAGGCGGCAGAAGGAGACTGG + Exonic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031992690 7:128208334-128208356 CCCAGTGGGCAGAAGAGGGCAGG - Intergenic
1032412785 7:131710896-131710918 ATCAGTGGGTAGTAGGAGGAAGG - Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033449287 7:141448627-141448649 CTCAGTGTCCAGACTGAGGGTGG + Intronic
1033483226 7:141762227-141762249 GTCAGGAGGAAGAAGGAGGGGGG + Intronic
1034011603 7:147534947-147534969 CTCAGTGGGCGCAAGGAAGCTGG + Intronic
1035304960 7:157926151-157926173 ATCAGTGGACAGATAGAGGGAGG - Intronic
1035324800 7:158058156-158058178 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324805 7:158058193-158058215 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324810 7:158058230-158058252 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324822 7:158058304-158058326 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324827 7:158058341-158058363 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324832 7:158058378-158058400 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324837 7:158058415-158058437 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324850 7:158058563-158058585 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324855 7:158058600-158058622 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324860 7:158058637-158058659 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324865 7:158058674-158058696 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324870 7:158058711-158058733 CACCGTGGGCAGATGGAGCGTGG - Intronic
1035324875 7:158058748-158058770 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324884 7:158058859-158058881 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324889 7:158058896-158058918 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324896 7:158058970-158058992 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324900 7:158059007-158059029 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324906 7:158059044-158059066 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324910 7:158059081-158059103 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324916 7:158059118-158059140 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324923 7:158059192-158059214 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324927 7:158059229-158059251 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324940 7:158059377-158059399 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324945 7:158059414-158059436 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324956 7:158059558-158059580 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324964 7:158059632-158059654 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324972 7:158059706-158059728 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324977 7:158059743-158059765 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324982 7:158059780-158059802 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324990 7:158059854-158059876 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035325010 7:158060076-158060098 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035365364 7:158345855-158345877 CTGAGGCGGCAGAAGGAGTGGGG + Intronic
1035391600 7:158508148-158508170 CACGGTGGGCAGAAGGCAGGTGG + Intronic
1035924482 8:3712321-3712343 CTCTGAGGGCAGTTGGAGGGAGG - Intronic
1036542329 8:9729120-9729142 CTCACTTGGCAGAAGGCGGAAGG + Intronic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1038247026 8:25867980-25868002 TTCAGTGGGCAGAGGGGGAGGGG - Intronic
1038401338 8:27287089-27287111 GTCAGAAGGCGGAAGGAGGGAGG - Exonic
1038626322 8:29196984-29197006 TTCAGTGGGAGGAAGGTGGGAGG - Intronic
1038832288 8:31074812-31074834 CTCAGTGGGCAGTGGGAGTAGGG + Intronic
1039288523 8:36068806-36068828 CTCAGTGTCCAGAAGGCTGGTGG - Intergenic
1039440500 8:37591967-37591989 CTCAATGGGCAAAGGCAGGGAGG + Intergenic
1040557942 8:48497671-48497693 CTCAGTGGGCAGTAAGTGTGAGG - Intergenic
1041113112 8:54506315-54506337 CTCAGTGCACAGTAGGAGTGAGG + Intergenic
1041242628 8:55861341-55861363 CTCACTTGGCAGAAAGAGGGAGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042014523 8:64293329-64293351 GGCAGTGGGAAGAAGGAGGTAGG - Intergenic
1043804751 8:84657829-84657851 ATCAGTGGGCTGGAGGAGGGAGG + Intronic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1045782786 8:105886986-105887008 CTGAGTGGGCAGAACGAGCCCGG + Intergenic
1045790259 8:105975803-105975825 CTCAAAGGGCAGAGAGAGGGTGG + Intergenic
1046429879 8:114110651-114110673 ATCAGAGGGCAGAGGGTGGGAGG + Intergenic
1046709413 8:117493032-117493054 GACAGAGGGTAGAAGGAGGGAGG - Intergenic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1047083835 8:121494414-121494436 GTCAGGGGGCAAAATGAGGGTGG + Intergenic
1047115876 8:121841504-121841526 CTCAGAAGACAGAAAGAGGGGGG + Intergenic
1047252868 8:123193779-123193801 CTCACATGGCAGAAGGAGTGAGG + Intronic
1047727139 8:127693858-127693880 CTTAGGGGCCAGCAGGAGGGTGG - Intergenic
1048329415 8:133461847-133461869 CCCTGTGGGCAGGGGGAGGGTGG + Intronic
1048335664 8:133500318-133500340 CACGGGGGCCAGAAGGAGGGAGG + Intronic
1049374063 8:142280783-142280805 GACAGTGGGGAGAAGGGGGGAGG + Intronic
1049722595 8:144126384-144126406 CTCAGTAGGCTGAGGCAGGGAGG - Intergenic
1049730310 8:144174025-144174047 CTCAGTTGGCAGAGGGGAGGTGG - Intronic
1049770752 8:144379915-144379937 CACAGTGCGCAGATGGACGGTGG + Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1051762914 9:20488189-20488211 GCCAGGGGTCAGAAGGAGGGGGG + Intronic
1052369216 9:27645415-27645437 CTCCCTGGGCAGGAGAAGGGCGG + Intergenic
1053282102 9:36827047-36827069 CCCACTGGGCAGTGGGAGGGTGG + Intergenic
1053441558 9:38120540-38120562 CTCTGTGGTCAGGAGGACGGCGG + Intergenic
1053722670 9:40963091-40963113 CTCAGACGGCAGAAGGCAGGAGG + Intergenic
1054343296 9:63888906-63888928 CTCAGACGGCAGAAGGCAGGAGG - Intergenic
1055810931 9:80146880-80146902 TTCAGAAGGCAGAAGGAAGGGGG + Intergenic
1056478820 9:86980256-86980278 CTCTGTGGTTAGGAGGAGGGAGG + Intergenic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057181312 9:93032267-93032289 CTCTGTGGGAAGCAGTAGGGTGG - Intronic
1057519875 9:95752144-95752166 CTGAGAGGGCAGCGGGAGGGGGG - Intergenic
1058560336 9:106221766-106221788 CTCACTTGGCAGAAGGGGAGTGG - Intergenic
1059423458 9:114206651-114206673 CTCATTTGGGAGCAGGAGGGAGG - Intronic
1060813045 9:126620631-126620653 CCCTGGGGGCAGACGGAGGGTGG + Intronic
1060918106 9:127403215-127403237 CTCAGTGGGGGAAAGGAAGGCGG + Intronic
1061423220 9:130483551-130483573 ATCAGTGGGGAGGAGAAGGGGGG + Intronic
1061498357 9:130988692-130988714 GGCAGTGGGCAGAAGGATGAGGG + Intergenic
1061761387 9:132854386-132854408 CTCCTGGGGCACAAGGAGGGTGG - Intronic
1061780203 9:132991402-132991424 CTCAGTGGGCAGCAGGCAGGTGG - Exonic
1061913532 9:133737614-133737636 CACAGTCGGAAGGAGGAGGGAGG - Intronic
1062035972 9:134382684-134382706 CTGAGTGGGCAGTATGAGGGTGG + Intronic
1062181739 9:135194599-135194621 CTCAGTGGCCAGGCTGAGGGAGG + Intergenic
1062214153 9:135380023-135380045 CACAGTGGGCATGAGGATGGAGG - Intergenic
1062432717 9:136533148-136533170 TTCAGTGGTCAGAAGGAGGCTGG - Intronic
1062622393 9:137428785-137428807 CTGGGTGGGCAGACCGAGGGAGG + Intronic
1186471368 X:9824642-9824664 CTCCCTGGGAAGAATGAGGGTGG + Intronic
1186471527 X:9825828-9825850 CTCCCTGGGAAGAATGAGGGTGG + Intronic
1186530488 X:10290476-10290498 CTCACTGGGAGGAAGGTGGGTGG + Intergenic
1186679664 X:11858546-11858568 TTCAGAGGGCAGAGGGTGGGAGG + Intergenic
1186796217 X:13048894-13048916 CTTAGTGGGGTGGAGGAGGGTGG - Intergenic
1187417087 X:19102754-19102776 CTCAGTTGGCAGAGAGAGGTGGG - Intronic
1188969132 X:36591686-36591708 ATCAGAGGGTAGAAGGTGGGAGG - Intergenic
1189722531 X:43934715-43934737 GTCAGGAGGCAGAAGGAGTGAGG - Intergenic
1190327535 X:49215952-49215974 CTCTGTGGGGAGATGGAGTGGGG - Intronic
1190957418 X:55209064-55209086 CTAAGTGGGCAGATGGTGGGAGG + Intronic
1191095103 X:56665446-56665468 CTCAGTGGTCTGGAGGATGGTGG - Intergenic
1191162226 X:57342365-57342387 TTCAGAGGGCAGAGGGTGGGAGG + Intronic
1193119069 X:77804895-77804917 GTGAGAGGGTAGAAGGAGGGAGG - Intergenic
1194704819 X:97162611-97162633 CTCAGTAGGCGAAAGCAGGGAGG - Intronic
1194834074 X:98659695-98659717 CTCAGTGGCCATAAGCAGGTTGG - Intergenic
1195956371 X:110335247-110335269 ATCAGTGGGCAGAGGGTGGGTGG + Intronic
1196627994 X:117899983-117900005 TTCTGTGGGCAGAGTGAGGGTGG + Intronic
1196915072 X:120525638-120525660 CTCTGTGGGAAAAATGAGGGAGG + Intronic
1197860622 X:130966224-130966246 CTGAGTTGGCAGTAGGAGGCTGG - Intergenic
1199417245 X:147599506-147599528 CTCACAGGGCAGAGAGAGGGAGG - Intergenic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic
1201579112 Y:15492569-15492591 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic