ID: 1170709930

View in Genome Browser
Species Human (GRCh38)
Location 20:18781478-18781500
Sequence TGTCAGCTAGTGATCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170709924_1170709930 22 Left 1170709924 20:18781433-18781455 CCCCAATAGGAAAAAAGCAAGCC No data
Right 1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG No data
1170709928_1170709930 1 Left 1170709928 20:18781454-18781476 CCTCTCTCAACTACAGCACTGGC No data
Right 1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG No data
1170709926_1170709930 20 Left 1170709926 20:18781435-18781457 CCAATAGGAAAAAAGCAAGCCTC No data
Right 1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG No data
1170709925_1170709930 21 Left 1170709925 20:18781434-18781456 CCCAATAGGAAAAAAGCAAGCCT No data
Right 1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170709930 Original CRISPR TGTCAGCTAGTGATCTTTGG TGG Intergenic
No off target data available for this crispr