ID: 1170710011

View in Genome Browser
Species Human (GRCh38)
Location 20:18781962-18781984
Sequence GGGGTGCTCACTTGGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170710002_1170710011 -1 Left 1170710002 20:18781940-18781962 CCTGATGTCCAGCCTGTTCCTGG No data
Right 1170710011 20:18781962-18781984 GGGGTGCTCACTTGGATCTCTGG No data
1170710007_1170710011 -9 Left 1170710007 20:18781948-18781970 CCAGCCTGTTCCTGGGGGTGCTC No data
Right 1170710011 20:18781962-18781984 GGGGTGCTCACTTGGATCTCTGG No data
1170710000_1170710011 9 Left 1170710000 20:18781930-18781952 CCCACTGTCTCCTGATGTCCAGC No data
Right 1170710011 20:18781962-18781984 GGGGTGCTCACTTGGATCTCTGG No data
1170710001_1170710011 8 Left 1170710001 20:18781931-18781953 CCACTGTCTCCTGATGTCCAGCC No data
Right 1170710011 20:18781962-18781984 GGGGTGCTCACTTGGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170710011 Original CRISPR GGGGTGCTCACTTGGATCTC TGG Intergenic
No off target data available for this crispr