ID: 1170710338

View in Genome Browser
Species Human (GRCh38)
Location 20:18785058-18785080
Sequence GAATTACTTCTACTGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170710338_1170710341 -1 Left 1170710338 20:18785058-18785080 CCAGGCCTCAGTAGAAGTAATTC No data
Right 1170710341 20:18785080-18785102 CCCTTCCCTAACAATCACGAAGG No data
1170710338_1170710346 21 Left 1170710338 20:18785058-18785080 CCAGGCCTCAGTAGAAGTAATTC No data
Right 1170710346 20:18785102-18785124 GAATTAAAACAGCATGCAATGGG No data
1170710338_1170710345 20 Left 1170710338 20:18785058-18785080 CCAGGCCTCAGTAGAAGTAATTC No data
Right 1170710345 20:18785101-18785123 GGAATTAAAACAGCATGCAATGG No data
1170710338_1170710348 26 Left 1170710338 20:18785058-18785080 CCAGGCCTCAGTAGAAGTAATTC No data
Right 1170710348 20:18785107-18785129 AAAACAGCATGCAATGGGGCTGG No data
1170710338_1170710347 22 Left 1170710338 20:18785058-18785080 CCAGGCCTCAGTAGAAGTAATTC No data
Right 1170710347 20:18785103-18785125 AATTAAAACAGCATGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170710338 Original CRISPR GAATTACTTCTACTGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr