ID: 1170711862

View in Genome Browser
Species Human (GRCh38)
Location 20:18798379-18798401
Sequence AAGGGCTTGATAAAGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170711855_1170711862 17 Left 1170711855 20:18798339-18798361 CCAGCTCTATGTTCTTGTGGATT No data
Right 1170711862 20:18798379-18798401 AAGGGCTTGATAAAGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170711862 Original CRISPR AAGGGCTTGATAAAGGCTGA TGG Intergenic
No off target data available for this crispr