ID: 1170714339

View in Genome Browser
Species Human (GRCh38)
Location 20:18818956-18818978
Sequence ACATGGCCAAAGAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 2, 1: 3, 2: 55, 3: 174, 4: 590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170714339 Original CRISPR ACATGGCCAAAGAAGGAGCA AGG Intronic
900811823 1:4808491-4808513 ACATGGGTAGAGCAGGAGCAAGG - Intergenic
901335412 1:8444764-8444786 ACATGGTGGAAGAAGGAGCAAGG - Intronic
901753174 1:11424514-11424536 CCATGGTGAAAGCAGGAGCAGGG - Intergenic
902792768 1:18780328-18780350 ACCTGGTGAAAGCAGGAGCAAGG + Intergenic
903899937 1:26636831-26636853 ACATCGGCAGAGAAGCAGCATGG - Intergenic
904887542 1:33752382-33752404 ATATGGTAAAAGTAGGAGCAAGG - Intronic
905643539 1:39608945-39608967 ATATGGCCAAAAATAGAGCATGG + Intergenic
906847822 1:49213505-49213527 ACATGGCGGAAATAGGAGCAAGG - Intronic
908539645 1:65110730-65110752 ACATGGCGAGAGAAGAAGCAAGG + Intergenic
908566751 1:65364683-65364705 ACATGGTAAAAGGAGGTGCAGGG + Exonic
909050640 1:70763726-70763748 AAGTGACCAAAGAAAGAGCAAGG + Intergenic
909492368 1:76239531-76239553 ACATGGTGAGAGAGGGAGCAAGG + Intronic
910286073 1:85555873-85555895 ACATGTCAAAATAAGAAGCATGG - Intronic
910295082 1:85636413-85636435 GCGTGGCCAGAGCAGGAGCAAGG - Intergenic
910337431 1:86150497-86150519 AGATGTCCAAAGAAAGAGAAGGG + Intronic
911202005 1:95054360-95054382 ACATGGGCAGAGCAGGAGGAAGG - Intronic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
911598157 1:99819934-99819956 ACATGGCTAAGGCAGGAGGATGG + Intergenic
911650196 1:100379829-100379851 ATATGGCAAGAGAGGGAGCAAGG + Intronic
911708456 1:101041705-101041727 ACATGGCCAGAGCAGGAGAGAGG + Intergenic
911756218 1:101560024-101560046 ACATGGTAAGAGAGGGAGCAAGG - Intergenic
911762047 1:101627546-101627568 ACATGGTGAAAGCAGAAGCAAGG - Intergenic
912129241 1:106581266-106581288 AAATTGGCATAGAAGGAGCATGG - Intergenic
912470385 1:109902647-109902669 ACAAGGCCACTGAAGGAGCAGGG - Intergenic
912863820 1:113238836-113238858 ACATGGCCACCAAAGAAGCAGGG + Intergenic
913348306 1:117829833-117829855 ACATGGCAAAAGCAGAAGCAAGG - Intergenic
913957282 1:143318073-143318095 GCAAGGCCAGAGAAGGACCATGG + Intergenic
913958205 1:143321669-143321691 ACAGGGCCACAGCAGGACCAGGG + Intergenic
913969771 1:143405804-143405826 ATGTGGCCAAAGCAGGAACAAGG - Intergenic
914051596 1:144143437-144143459 GCAAGGCCAGAGAAGGACCATGG + Intergenic
914052520 1:144147044-144147066 ACAGGGCCACAGCAGGACCAGGG + Intergenic
914064144 1:144231397-144231419 ATGTGGCCAAAGCAGGAACAAGG - Intergenic
914115006 1:144734957-144734979 ATGTGGCCAAAGCAGGAACAAGG + Intergenic
914126677 1:144819497-144819519 ACAGGGCCACAGCAGGACCAGGG - Intergenic
914127601 1:144823104-144823126 GCAAGGCCAGAGAAGGACCATGG - Intergenic
914521282 1:148419033-148419055 ACATGGCCAGAGCAGGAGAGAGG + Intergenic
915605676 1:156948622-156948644 ACATGGCCAAAGCAGCTGGATGG + Intronic
917272321 1:173291188-173291210 ACGTGGTAAAAGCAGGAGCAAGG + Intergenic
917813039 1:178679023-178679045 ACATGGCAAGAGAAGAAGCAGGG + Intergenic
918143784 1:181738642-181738664 ACATGGCCCAAGTAGGAGGCAGG + Intronic
918544942 1:185671850-185671872 AGATGGCCAAAGACAGAGGATGG - Intergenic
918912176 1:190589276-190589298 ACATGGCAAAAGCAGGAGCAAGG + Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
919252968 1:195083134-195083156 ACATGGAAAAAGAGGAAGCAAGG + Intergenic
920496681 1:206459930-206459952 ACCTGGCCAAGGAGGGAGCTGGG - Intronic
920615700 1:207490896-207490918 ACATGGCAGAAGCAGGATCAAGG + Intergenic
920631434 1:207656660-207656682 ACATGGCAGGAGCAGGAGCAAGG + Intronic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
922977968 1:229800916-229800938 ACATGGCGAGAACAGGAGCAAGG - Intergenic
923097017 1:230783512-230783534 ACATGGCAAAAGCAGGAGCAGGG - Intronic
923097290 1:230785551-230785573 ACATGGAAAAAGCAGGAGCAGGG - Intronic
923211129 1:231805467-231805489 ACACGGCCAGAGCAGGAGGAGGG + Intronic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
923639474 1:235739366-235739388 ACATGTTCAATGAAGGAGCCAGG - Intronic
923993239 1:239463377-239463399 AAAGGGCAAAAGAATGAGCAAGG - Intronic
1063070172 10:2653763-2653785 ACATGGACAGAGAAGGACCATGG - Intergenic
1063470116 10:6277630-6277652 ACATGGCCAGAGCAGGAGGGAGG - Intergenic
1063512076 10:6655415-6655437 ACATGGCAATAGCAGGAGCAAGG - Intergenic
1063624910 10:7679884-7679906 ACATGGCCAGAGCAGGAGCTAGG + Intergenic
1063675469 10:8137561-8137583 ACAGAGCCAAGGAAGGAGAAAGG - Intergenic
1063853674 10:10222483-10222505 ACATGGCAAAAGTAGGAGTCAGG + Intergenic
1064219820 10:13431147-13431169 ACTGGGCCCAAGAAGGAGCTGGG + Intergenic
1064234977 10:13565377-13565399 AAATGGCCGGAGCAGGAGCAGGG - Intergenic
1064960951 10:20964478-20964500 ACATGGCAAGACAGGGAGCAAGG + Intronic
1065444103 10:25780038-25780060 GCATGGCAGAAGCAGGAGCAAGG + Intergenic
1065626601 10:27635592-27635614 ACATGGCAAAAGCAGGAGCAAGG - Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1066696091 10:38078794-38078816 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1066760375 10:38742522-38742544 ACAAGGCCAGAGAAGGACCACGG - Intergenic
1066961225 10:42230231-42230253 CCAAGGCCAGAGAAGGACCACGG + Intergenic
1066996447 10:42568744-42568766 ACAAGGCCAGAGTAGGAGCAAGG - Intergenic
1068212052 10:53932981-53933003 CCATGGCAAAAGCAGTAGCAAGG - Intronic
1068304531 10:55189110-55189132 TCATGGCTACACAAGGAGCATGG + Intronic
1068595594 10:58899784-58899806 ACATGGCCAGAGCAGGAAGAAGG - Intergenic
1068676270 10:59772569-59772591 ACATGGTCAAAGCAGGAACTTGG + Intergenic
1068733786 10:60389246-60389268 ACATGGCCATAGGATGGGCAAGG - Intronic
1068889309 10:62132312-62132334 ACATGGCCAGAGAAGGAGGAAGG - Intergenic
1068891360 10:62151302-62151324 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1069627783 10:69878829-69878851 TGATGCCCAAGGAAGGAGCAGGG + Intronic
1069817362 10:71206953-71206975 ACATGGTGAAAGGAGGAGGATGG - Intergenic
1070272116 10:74966209-74966231 AAATGGCAAAAGGAGGAGGAAGG - Intronic
1070933099 10:80274466-80274488 ATCTGGGCAAGGAAGGAGCAAGG + Intronic
1071119854 10:82264659-82264681 ATGTTGCCAATGAAGGAGCAGGG + Intronic
1071797438 10:89021559-89021581 ACATGACCAGGGAAGGAGCAAGG - Intergenic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1072201003 10:93158767-93158789 ACATGGCAAGAGAGTGAGCAAGG - Intergenic
1073841251 10:107501611-107501633 ACATGGCCATTCAAGCAGCAAGG - Intergenic
1073863846 10:107778207-107778229 ACATCGGGAAAGATGGAGCATGG + Intergenic
1074581820 10:114726458-114726480 ACATGGCAAAAGCAGGAGAAAGG + Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1076240509 10:128901872-128901894 ACAAGGGCAAAGAAGAAGCTGGG + Intergenic
1077280163 11:1740957-1740979 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1077447666 11:2606501-2606523 ACATGGCAAGAGCAGGAGCAAGG - Intronic
1077533934 11:3110086-3110108 GGATGGCCCAGGAAGGAGCATGG + Intronic
1077730592 11:4725086-4725108 ACATGGCTGAAGAAGGAGCAAGG - Intronic
1077868674 11:6243381-6243403 ACACGGTGAAAGCAGGAGCAAGG + Intronic
1078025243 11:7688792-7688814 TCATGGACAAACAAGGAACAGGG + Intergenic
1078424526 11:11238514-11238536 AGATGGCCAACGATGGAGCTGGG + Intergenic
1078650843 11:13190841-13190863 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1078718124 11:13858969-13858991 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1078724051 11:13912652-13912674 ACATGGCCAGAGCAGGAGAAAGG - Intergenic
1079884822 11:25973890-25973912 ACATTGCCAAATAATGATCATGG + Intergenic
1079992351 11:27259535-27259557 ACATGGCCAGAACAGGAGGAAGG + Intergenic
1080158347 11:29140233-29140255 ACATGGCAAATGTAGGAGCCAGG - Intergenic
1080603937 11:33848310-33848332 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1080822165 11:35817848-35817870 ACATGGCCAGAGCAGAAGGAAGG - Exonic
1081068223 11:38575880-38575902 ACATGGCAAGAGCAGGAGCAAGG + Intergenic
1081243164 11:40731371-40731393 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1081940212 11:46935307-46935329 ACAGAGCCAAAGTAGGAGCAGGG - Intergenic
1082739277 11:56892564-56892586 AAATGGCTTAAGAAGGAACAGGG + Intergenic
1082950390 11:58808838-58808860 ACATGGCCAGAGCAGGAAGAAGG + Intergenic
1083019718 11:59494566-59494588 ACAAGGTCAAAGAAACAGCAAGG + Intergenic
1083286280 11:61661208-61661230 ACATGGCCAGAGGGGGAGCAAGG + Intergenic
1083554825 11:63617798-63617820 ACATGGCCAGAGCAAGAGAAAGG - Intergenic
1083888958 11:65586268-65586290 ACATGGTCCCAGAAAGAGCAGGG + Intronic
1083988978 11:66235076-66235098 GCGTGGCCCAAGAAAGAGCAGGG + Intronic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1085057906 11:73418351-73418373 ACATGGTGAGAGAGGGAGCAAGG - Intronic
1085241230 11:75058156-75058178 ACATGGCAGGAGCAGGAGCAAGG + Intergenic
1085395488 11:76205174-76205196 ACTTGGCCTGAGAAGGGGCAGGG + Intronic
1085600624 11:77853396-77853418 ACATGGCCAGAGCAGGAGGCAGG + Intronic
1085648128 11:78241203-78241225 ACATAGGCAAAGAAGCTGCATGG + Intronic
1085765746 11:79280297-79280319 AGATGGCCACAAAAGGAGGAAGG - Intronic
1085939800 11:81195462-81195484 ACATGGCTGGAGCAGGAGCAAGG - Intergenic
1086146802 11:83561046-83561068 ACAAGGCCAGAGCAGGAGCAAGG + Intronic
1086302479 11:85442620-85442642 GGAAGGCCAAAGAAGGAGGATGG + Intronic
1086530331 11:87777489-87777511 ACGTGGCCAGAGCAGGAGGAAGG - Intergenic
1086774758 11:90816411-90816433 ATATGGCAAGAGAGGGAGCAAGG + Intergenic
1087101108 11:94365529-94365551 ACATGGCGAGAGTGGGAGCAAGG - Intergenic
1087125805 11:94624728-94624750 AGAAGGCCAAAAAGGGAGCAAGG - Intergenic
1087423129 11:97957630-97957652 ACACGGTGAAAGAAGGAACAAGG + Intergenic
1087431608 11:98063437-98063459 ACATGGCAAAAGCAGGAGAGAGG + Intergenic
1087433220 11:98080028-98080050 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1087660318 11:100980323-100980345 GCATGGCAGAAGAAGTAGCAAGG - Intronic
1088553328 11:111036765-111036787 ACATGGTGAGAGAGGGAGCAAGG - Intergenic
1088938913 11:114434279-114434301 ACATGGCCAGAGCAGGAGCAAGG + Intronic
1089149044 11:116350743-116350765 ACATGGCCCACGTAGGTGCAAGG + Intergenic
1089340596 11:117754766-117754788 CTATGGCCAAAGAGGCAGCACGG - Intronic
1089899805 11:121968592-121968614 ATATGGGCACAGCAGGAGCAGGG - Intergenic
1090005875 11:123001853-123001875 ACATGGCAGGAGCAGGAGCAAGG - Intergenic
1090324393 11:125872043-125872065 ACCTGAACAAAGAAGGAGAAGGG + Intergenic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1090479855 11:127058629-127058651 ATGTGGCCAAAGAGGGAGCAGGG - Intergenic
1090834100 11:130441367-130441389 ATGTGGCCAGAGCAGGAGCAAGG + Intergenic
1090854604 11:130600684-130600706 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1090988504 11:131795010-131795032 ACAGGGTCCAGGAAGGAGCACGG - Intronic
1091084304 11:132705640-132705662 ACACGGCAAAAGCAGGAGCAAGG - Intronic
1091146333 11:133283377-133283399 ACATGGCAAGAGTAGGAACAAGG - Intronic
1091283238 11:134394141-134394163 ACCAGGGCAAAGGAGGAGCAGGG - Intronic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1092459360 12:8672764-8672786 ACATGGTGAAAGCAGGAGCACGG - Intergenic
1092473292 12:8796997-8797019 ACATGGTGAAAGCAGGAACAAGG + Intergenic
1092876092 12:12849192-12849214 ACATGGCAGAAGCAGGACCAAGG - Intergenic
1092970262 12:13686997-13687019 ACATGGTGAGAGAAGAAGCAAGG - Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093168896 12:15836994-15837016 ACATGGCCAGGGCAGGAGCCGGG + Intronic
1093293631 12:17360414-17360436 ACATGGTCAGAGTAGGAGGAAGG - Intergenic
1093698368 12:22189165-22189187 ACATGGCAAGAGTGGGAGCAGGG - Intronic
1093764021 12:22942135-22942157 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1093905889 12:24691436-24691458 ACATGGCAAAAGAGAGAGCAAGG + Intergenic
1094456851 12:30644561-30644583 AGATGGCCAAGGAAGGAGACAGG + Intronic
1094746546 12:33350917-33350939 ACATGGCAGTAGCAGGAGCAAGG + Intergenic
1094786800 12:33858711-33858733 ACATGGCCAGAGTAGGGGGAAGG - Intergenic
1096380793 12:51156323-51156345 ACATGGCAACAGAGGAAGCAAGG + Intronic
1096408273 12:51359277-51359299 ACATGGCCTACGACAGAGCAGGG + Exonic
1097978288 12:65710920-65710942 ACATGGTCAGAGCAGGAGCAAGG - Intergenic
1098391105 12:69970924-69970946 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1099807762 12:87542144-87542166 ACATGGCAAAAGCAGAAGGAGGG - Intergenic
1099913700 12:88865297-88865319 CCATGGTCCAAGAAGGAACATGG + Intergenic
1099930963 12:89074094-89074116 GCCTGGCTGAAGAAGGAGCAAGG + Intergenic
1099990236 12:89713738-89713760 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1100208433 12:92376327-92376349 ACATGGCAAAAGCAGGAGCAAGG - Intergenic
1100807781 12:98305257-98305279 ACAAGGCAAGAGAGGGAGCAAGG - Intergenic
1100965382 12:100007352-100007374 ATATGGTGAAAGCAGGAGCAAGG + Intergenic
1101291523 12:103374764-103374786 ACATGGCCCAGGATGCAGCATGG - Intronic
1101376979 12:104179673-104179695 CCACGGCGAAAGCAGGAGCAAGG + Intergenic
1101469445 12:104982963-104982985 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1102506095 12:113385342-113385364 ACATTGCCTAGGAAGGAGCTGGG - Intronic
1102600059 12:114022851-114022873 ACATGGCAGGAGCAGGAGCAAGG + Intergenic
1103137258 12:118518404-118518426 ACATGGCCCAAGCAGGAAGAAGG + Intergenic
1103177768 12:118879399-118879421 ACGTGGCAAAAGCAGGAGCGAGG + Intergenic
1103391027 12:120573713-120573735 ACATGGCTAAAGAGGAAGCAAGG + Intronic
1103557337 12:121774702-121774724 ACATGGCCACAGAAGAGGAAGGG - Exonic
1103844540 12:123892304-123892326 CCATGGCCAGAGTGGGAGCAAGG + Intronic
1104112191 12:125714517-125714539 ACATGGCGAGACAAGGAGCAAGG - Intergenic
1104133265 12:125915024-125915046 ACCTGGCCAAAGAGGGCACATGG + Intergenic
1104502401 12:129298791-129298813 AGAGAGCCAAAGAAGGAGAATGG + Intronic
1104538091 12:129637547-129637569 ACATGGCCAGACCAGGAGGAAGG - Intronic
1104538130 12:129637792-129637814 ACATGGCAGGAGAAGGAGCAAGG + Intronic
1105046610 12:133008945-133008967 ACATGGTGAAAGCAGGAGTAAGG + Intronic
1105811250 13:23997716-23997738 ACATGGCAAGAGAGGGAACAAGG + Intronic
1106383866 13:29265707-29265729 ACATGGCAAAAGCAGGAGCAAGG + Intronic
1106811454 13:33362242-33362264 ACATGGCAAGAGCAAGAGCAAGG + Intergenic
1106871871 13:34030518-34030540 ACAAGGCCAAAGACCGAGCCTGG + Intergenic
1107130483 13:36888938-36888960 ACATGGCCAGAGGAGAAGAAGGG + Intronic
1107531568 13:41287292-41287314 ACATGGCCAGAGCAGGAGTAAGG + Intergenic
1107938442 13:45364283-45364305 ACATGGAGAAAGCAGGAGCAGGG - Intergenic
1107939954 13:45374683-45374705 ACATGGCCAGAGAAGCAGAAAGG - Intergenic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109057137 13:57565004-57565026 ACATGGTGACAGAAGAAGCAAGG - Intergenic
1109242135 13:59902336-59902358 ACATGGCCAGAGAAGGAGTAAGG - Intronic
1109486351 13:63026633-63026655 AGAATGCCAAAGAAGGAGTAAGG + Intergenic
1109600922 13:64627462-64627484 ACAGAGTCAGAGAAGGAGCAAGG - Intergenic
1110062801 13:71063477-71063499 ACATGGCCAGATCAGGAGGAAGG + Intergenic
1110512393 13:76366335-76366357 ATATGGCAAAAGCAGGAGCAAGG - Intergenic
1110763815 13:79259664-79259686 ATAAGGCAAAAGAAGTAGCAAGG - Intergenic
1112105091 13:96231492-96231514 ACATGGCCAGAGCAGGAGGAAGG + Intronic
1112286244 13:98107070-98107092 ATATGGTGAAAGCAGGAGCAAGG + Intergenic
1112363687 13:98739574-98739596 ACATGGCTGGAGTAGGAGCAAGG - Intronic
1112515411 13:100049035-100049057 ACATGACCAGAGCAGAAGCAAGG + Intergenic
1113086225 13:106571869-106571891 ACATGGCCAGAGCCTGAGCAGGG - Intergenic
1113755066 13:112805122-112805144 ACACGGCTAATGAAAGAGCAAGG + Intronic
1114033137 14:18593844-18593866 ACATGGCAAGAGAGGGAGAAAGG - Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1115268390 14:31525626-31525648 ACATGGTGAAAGCAGGAACAAGG + Intronic
1115309004 14:31960882-31960904 ACATGGTGAGAGAGGGAGCAAGG + Intergenic
1115350688 14:32391694-32391716 ACATGGCCAGAACAGAAGCAAGG - Intronic
1115658301 14:35465260-35465282 ACATGGCCAAAGAAGCAGGAAGG - Intergenic
1115916406 14:38320511-38320533 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1116420518 14:44726990-44727012 ACATGGTGAGAGAGGGAGCAAGG - Intergenic
1116881830 14:50178301-50178323 ACATGGTCAAAGCAAGAGGAAGG - Intronic
1117128159 14:52654812-52654834 ACATAGAAAAAGAAGGAGAAGGG - Intronic
1117209764 14:53483311-53483333 ACACGGCCAGAGCAGGAGCAAGG + Intergenic
1117496664 14:56312485-56312507 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1117800081 14:59434201-59434223 ACATGGCAAGAATAGGAGCAAGG + Intronic
1118307508 14:64667568-64667590 ACATGGTGAGAGAGGGAGCAAGG + Intergenic
1118414129 14:65514491-65514513 AAATGGCCATAGCAGGAACAAGG - Intronic
1118495375 14:66303568-66303590 ACATGGCGAGAGCAGGAGCAAGG - Intergenic
1119094503 14:71816548-71816570 ACATGGCAAAAGCAGGAGCAAGG + Intergenic
1119391845 14:74296169-74296191 ACAGGGCCAAAGGAAGGGCAGGG + Intronic
1120005915 14:79357910-79357932 ACTGAGCAAAAGAAGGAGCAAGG - Intronic
1120139309 14:80910490-80910512 ACATGGCCGGAGTAGGAGCACGG - Intronic
1120268321 14:82278377-82278399 ACATGGCCAAAGCAGGATCAAGG - Intergenic
1120288444 14:82535397-82535419 ACATGGCGAGAGCAGGAACAAGG + Intergenic
1120388520 14:83876302-83876324 ACATGGCAGAAGCAGAAGCAAGG - Intergenic
1120915089 14:89703470-89703492 ACATGGCCAGGGCAGGACCAAGG + Intergenic
1121407829 14:93729615-93729637 TCAGGGCCAAAGGAGGGGCATGG - Intronic
1121678812 14:95775938-95775960 ACATTGCGAAAGCAGGAGCAAGG + Intergenic
1122043948 14:99010217-99010239 ACATGGCCAGAGCAGGAGGAGGG + Intergenic
1122518680 14:102327099-102327121 ATATGGCCACAGCAGGAACAAGG + Intronic
1122832059 14:104403188-104403210 CCATGGCCAGAGAAGGAGGAAGG - Intergenic
1123009498 14:105340924-105340946 ACGTGGCCAGAGACGGGGCAAGG - Intronic
1202930934 14_KI270725v1_random:31460-31482 GCATGGCCAAAAACAGAGCAGGG - Intergenic
1202931085 14_KI270725v1_random:31972-31994 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1123421344 15:20139706-20139728 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1123443784 15:20307085-20307107 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1123530570 15:21146246-21146268 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1123687141 15:22806788-22806810 TCCTGGCAAAAGAAGGAGGAGGG + Intronic
1123736677 15:23191228-23191250 ACATGGGGAGAGAGGGAGCAAGG - Intergenic
1123875393 15:24618707-24618729 ACATGGTCAGAGAAGGACCAAGG + Intergenic
1123937013 15:25198930-25198952 TCATGGCCAACCAAGGAGAATGG - Intergenic
1123946026 15:25239317-25239339 TCATGGCCAACCAAGGAGCGTGG - Intergenic
1124086877 15:26559273-26559295 ACATGGCAAAAGTAGGAACAAGG - Intronic
1124132183 15:27000647-27000669 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1124287378 15:28414203-28414225 ACATGGGGAGAGAGGGAGCAAGG - Intergenic
1124287901 15:28419905-28419927 ACATGGGGAGAGAGGGAGCAAGG - Intergenic
1124295325 15:28497422-28497444 ACATGGGGAGAGAGGGAGCAAGG + Intergenic
1125397779 15:39269189-39269211 AACTGGCCCAAGCAGGAGCATGG + Intergenic
1125398781 15:39278173-39278195 ACATGGCAGGAGAAGGACCAAGG - Intergenic
1125452386 15:39823058-39823080 AAATAGCCAAAGCAGTAGCAGGG - Intronic
1126218157 15:46181424-46181446 ACATGGAAAGAGAGGGAGCAAGG + Intergenic
1127043302 15:55000901-55000923 ACATGGCAACAACAGGAGCAAGG + Intergenic
1127330773 15:57937592-57937614 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1127332285 15:57950907-57950929 GCAGGGCCACAGAAGCAGCATGG + Intergenic
1127518945 15:59724117-59724139 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1127960441 15:63886655-63886677 CCATGGCTTGAGAAGGAGCAAGG + Intergenic
1128270636 15:66306212-66306234 CCATGGCCGAGGAAGGAGAATGG - Intronic
1128534037 15:68476857-68476879 ACATGGAGAAACCAGGAGCAAGG - Intergenic
1129130051 15:73485625-73485647 TCATGGCAAGAGCAGGAGCAAGG - Intronic
1129138258 15:73573672-73573694 ATATGGCGCAAGAAGGAGAACGG - Exonic
1129173646 15:73823585-73823607 ACATGGCAAAAGTGGGAGCAAGG + Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1130107321 15:80938599-80938621 AGATGGGCAAAGAAGGCACAGGG + Intronic
1130920928 15:88344026-88344048 ACATGGCCAGAGCAAGAGGAAGG + Intergenic
1131364139 15:91823448-91823470 TTATGGCCAGAGCAGGAGCAAGG - Intergenic
1131371010 15:91881900-91881922 ACCTGGCCAGGGATGGAGCAGGG - Intronic
1131527572 15:93164802-93164824 ACACGGCAAAAGCAGGATCAAGG - Intergenic
1131665208 15:94564254-94564276 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1132362193 15:101225614-101225636 ACATGGCACAAGTGGGAGCAAGG - Intronic
1133547504 16:6822005-6822027 ACATGACCAAATAGGGAGCATGG + Intronic
1133854321 16:9535354-9535376 ACATGGCTAATAAAGGAACAAGG - Intergenic
1133963763 16:10516701-10516723 ACATGGCCAGGGCAGGAGCAAGG - Intergenic
1135850669 16:25960171-25960193 ACATGGCCAGAGAGTGAGCAAGG - Intronic
1136402740 16:30027421-30027443 ACCTGGCCAAGGAAGGGACATGG + Intronic
1136922286 16:34343347-34343369 ACATGGGGTCAGAAGGAGCATGG + Intergenic
1136982287 16:35068459-35068481 ACATGGGGTCAGAAGGAGCATGG - Intergenic
1137418391 16:48307937-48307959 ACATGGTGAGAGAGGGAGCAAGG + Intronic
1138068143 16:53963613-53963635 ACGTGGCCAGATCAGGAGCAAGG - Intronic
1138198983 16:55075042-55075064 CCATGGCCGGTGAAGGAGCAAGG + Intergenic
1138540812 16:57686287-57686309 ACATGGCGAGAGTGGGAGCAAGG + Intronic
1138894578 16:61188089-61188111 ATATGGCGAAAGAGGGAACAAGG + Intergenic
1138968924 16:62121142-62121164 AAAAGGCAAAAGAATGAGCAGGG - Intergenic
1139352863 16:66348169-66348191 CCATGTCCAATGAAGGAGCAAGG + Intergenic
1140067164 16:71621383-71621405 ACATGTCGAGAGAGGGAGCAAGG + Intergenic
1140343408 16:74188268-74188290 ACATGGCCAGAGTGGGAGCCGGG + Intergenic
1140467142 16:75191590-75191612 ACATGACAAAATTAGGAGCAGGG + Intergenic
1141028471 16:80568885-80568907 ACATGGGGCAGGAAGGAGCATGG - Intergenic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1142751617 17:1992030-1992052 ACATGGGCCACGTAGGAGCAAGG + Intronic
1143439272 17:6955869-6955891 ACATGGCGAGAGAGGAAGCAAGG - Intronic
1143684641 17:8504097-8504119 ACATGGCCAGAGAAGGCTCCTGG - Intronic
1144004490 17:11087963-11087985 ACATGGCCATAGCGGGATCAAGG + Intergenic
1144121441 17:12157771-12157793 GCATGGCCAGAGCAAGAGCAAGG - Intergenic
1144221191 17:13101357-13101379 ACATGGCCAGGGCAGGAGGAAGG - Intergenic
1144357795 17:14462415-14462437 ACATGGCAAAAGTAGGAGGGCGG + Intergenic
1144720658 17:17467456-17467478 ACATGGCCTCACATGGAGCAGGG + Intergenic
1145253920 17:21312333-21312355 ACAGGGCCCAGGAAGGTGCAGGG - Intronic
1145322674 17:21775626-21775648 ACAGGGCCCAGGAAGGTGCAGGG + Intergenic
1146296274 17:31653144-31653166 ACATGGCAAGAGAAAGGGCAAGG + Intergenic
1146951554 17:36910163-36910185 GCATGGGCAAAGAAGGAGAAAGG + Intergenic
1147298931 17:39508337-39508359 TCATGTCCCAAGAAGTAGCAAGG + Intronic
1148196184 17:45715080-45715102 ACATAGCCAGAGCAGGGGCAAGG + Intergenic
1148688934 17:49515629-49515651 ACTTGGCCAAACAACCAGCAGGG - Intergenic
1148742484 17:49900735-49900757 ACATGGGCAGAGAAGGGGAAGGG - Intergenic
1149148999 17:53536456-53536478 ATGTGGTGAAAGAAGGAGCAAGG - Intergenic
1150178843 17:63092660-63092682 ACATGGCGGGAGCAGGAGCAAGG + Intronic
1151148836 17:72066251-72066273 ACATGGTTAAAGCAGGATCAAGG + Intergenic
1151189369 17:72387043-72387065 AAATGGCCCAGGAAGGAGGATGG + Intergenic
1151568663 17:74915164-74915186 GGATGGCCAAAGAAGCCGCAGGG + Intergenic
1151902223 17:77023940-77023962 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1151905258 17:77043905-77043927 ACATGGCAGGAGCAGGAGCAAGG + Intergenic
1153311607 18:3682218-3682240 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1153738717 18:8100078-8100100 ACATGGTGAAAGCAGGAGCAAGG + Intronic
1155107949 18:22686425-22686447 ACATGGCAAAAGAGGGAGCAAGG + Intergenic
1155207377 18:23572149-23572171 ACATTGCCAAAGAAGAATCCTGG + Exonic
1155450343 18:25956846-25956868 AAATGGCGAGAGCAGGAGCAAGG + Intergenic
1155829389 18:30493635-30493657 ACATGGCAATAGAAGGAGCAAGG - Intergenic
1156090826 18:33466638-33466660 ACATGGCCAGAGCAGGAAAAAGG - Intergenic
1156154574 18:34286976-34286998 ACATGGTGAGAGCAGGAGCAAGG + Intergenic
1156543069 18:37936159-37936181 ACATAGCCAGAGTAGGAGCAAGG + Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1156736369 18:40264100-40264122 ACATGGCAAGAAAGGGAGCAAGG - Intergenic
1157553510 18:48597576-48597598 ACATGGCCAGGGCAGGAGCAAGG - Intronic
1158517667 18:58144341-58144363 ACGTGGCCAGAGCAGGAGCAAGG + Intronic
1159261735 18:66022203-66022225 ACATGGTGAAAGGAGGAACAAGG + Intergenic
1159344150 18:67176714-67176736 ACATGGCAAACGAATGAGAATGG + Intergenic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1159443760 18:68513917-68513939 AAATGGTCAAATAAGGAGCTAGG - Intergenic
1160632160 18:80254265-80254287 TGATGGCCAAAGAAGGAGACAGG - Intergenic
1162178282 19:8847800-8847822 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1162498687 19:11038463-11038485 ACCGGGTCAAAGAAGCAGCATGG - Intronic
1163114618 19:15181418-15181440 GCAGGGCCAGGGAAGGAGCAGGG - Intronic
1163730900 19:18948691-18948713 CCAAGGCCACAGAAGGAGCGTGG - Intergenic
1163834895 19:19567260-19567282 ACAAGGCCAGAGCTGGAGCAAGG - Intronic
1163853858 19:19684041-19684063 ACAAGGCAAGAGTAGGAGCAAGG + Intergenic
1164538226 19:29102765-29102787 ACATGGCCAGAGCAGCAGGAAGG - Intergenic
1166763465 19:45238771-45238793 ACACGGCCCAAGAAAGAGCGGGG + Intronic
1167095289 19:47372151-47372173 ACATGGAGAAAGATGGGGCAGGG - Intronic
1167285494 19:48596680-48596702 ACTCGGCCAAGGAAGGAGCGTGG - Intronic
1167484338 19:49752418-49752440 ACCTGGCAAGAGCAGGAGCAAGG - Intronic
1167724314 19:51200298-51200320 GCATGGCCAGAGAAGTGGCAGGG - Intergenic
1167829074 19:52003558-52003580 ATCTGGGCAAAGAAGGATCAGGG - Intronic
1168010769 19:53530125-53530147 ACATGGCAAAAGGAGGGGTAAGG + Intronic
1168192673 19:54751208-54751230 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168194761 19:54766036-54766058 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168197011 19:54782481-54782503 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168200596 19:54812688-54812710 ACATGGCAAGAGAGGGAGAAAGG + Intronic
1168202807 19:54828920-54828942 ACACGGCAAGAGAGGGAGCAAGG + Intronic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1202690993 1_KI270712v1_random:95861-95883 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1202691918 1_KI270712v1_random:99468-99490 ACAGGGCCACAGCAGGACCAGGG + Intergenic
925229763 2:2222614-2222636 ATATGGCCAAAAAAGGAACCAGG - Intronic
925370295 2:3339988-3340010 ACATGGCCGAAGCAGGAGCTAGG - Intronic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
925889755 2:8424114-8424136 ACATGACAAAAGCAGGAGCAAGG + Intergenic
926279277 2:11431801-11431823 ACATGGCAAAAGCAGGAGTAGGG - Intergenic
926350666 2:11991291-11991313 ACATGGCAAGAGCAGGGGCAAGG - Intergenic
926470410 2:13248345-13248367 ATCTGTACAAAGAAGGAGCAAGG - Intergenic
927895850 2:26781339-26781361 ATGTGGCCAGAGTAGGAGCAAGG + Intronic
928216355 2:29364616-29364638 AAATGGCCAAAGAAGAGTCAGGG + Intronic
928756797 2:34536246-34536268 ACATGCCTAAGGAAGGAGAAAGG - Intergenic
928769642 2:34691485-34691507 ACATAGACAAAGAAGGAAAAAGG + Intergenic
929371994 2:41236706-41236728 CAATAGCCAAAGGAGGAGCAAGG + Intergenic
930167773 2:48220165-48220187 AGGTGGCTAAAGAGGGAGCAAGG + Intergenic
930314064 2:49775939-49775961 ACATGGTGAAAGTAGGAGCAAGG + Intergenic
930813370 2:55566513-55566535 ACCTGGTAAAAGAAGGAACATGG - Intronic
930842375 2:55861868-55861890 ACATGGCCAGAACAGGAGCAAGG + Intergenic
931654642 2:64500093-64500115 ACATGGTGAGAGAGGGAGCAAGG + Intergenic
931716964 2:65037023-65037045 AAATGGACAAAGATGGAGTATGG - Intergenic
932060613 2:68494435-68494457 ACATGTTGAAAGCAGGAGCAAGG + Intronic
932285257 2:70526105-70526127 AAATGGTCACAGAAGGACCATGG + Intronic
933850715 2:86364542-86364564 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
933878405 2:86643727-86643749 ACATGGCCGGAGCAGGAGCAAGG - Intronic
933955401 2:87358090-87358112 GCAAGGCCAGAGAAGGACCATGG - Intergenic
934239586 2:90254301-90254323 GCAAGGCCAGAGAAGGACCATGG - Intergenic
934273606 2:91562439-91562461 GCAAGGCCAGAGAAGGACCATGG + Intergenic
934461863 2:94217100-94217122 GCATGGCCAAAAACAGAGCAGGG - Intergenic
934462026 2:94217641-94217663 GCAAGGCCAGAGAAGGACCATGG - Intergenic
934546801 2:95224515-95224537 ACATGGCCAGAGCAGGAGAGGGG + Intronic
935096761 2:99952258-99952280 ACATGGTCAGAGCAGGAGGAAGG - Intronic
935524724 2:104151745-104151767 AGGTGGTCAAAGAAGGAGCTAGG + Intergenic
935798866 2:106672167-106672189 ACATGGCCAAAGCAGGAGGAAGG - Intergenic
935873924 2:107485707-107485729 ACATGGCCAAAGAGGAAGAGGGG - Intergenic
935931541 2:108132443-108132465 ACATGGTGAGAGCAGGAGCAAGG + Intergenic
936734560 2:115425885-115425907 ACATGGGAAAAGCAAGAGCAAGG + Intronic
937223549 2:120355571-120355593 ACCTGGCCAGAGATGGTGCATGG - Intergenic
937465215 2:122126366-122126388 ACATGTCCAGAGCAGGAGGAAGG - Intergenic
937504999 2:122526988-122527010 ACCTGGGCATAGAAGGAGGAGGG - Intergenic
937570413 2:123351307-123351329 ACATGGTCAGAGCAGGAGGAAGG - Intergenic
937875949 2:126825460-126825482 ACATGGTGAGAGAAAGAGCAAGG - Intergenic
938722232 2:134076918-134076940 ACATGGCCAGAGTAGGAGGCGGG - Intergenic
938841024 2:135163672-135163694 ACATGGGCAAAAAATGAACAGGG - Intronic
939015097 2:136893400-136893422 CCATGGCCGAAAAAGGTGCAGGG - Intronic
939181654 2:138810096-138810118 TCCTGGCCACAGAAGGAGCCAGG - Intergenic
940904504 2:159157079-159157101 GCAAGGCCAGAGAGGGAGCAGGG + Intronic
941997110 2:171611254-171611276 ACACGGCGAGAGAGGGAGCAAGG - Intergenic
942137386 2:172940493-172940515 ACATGGAAAAAGCAGGAACAAGG - Intronic
943016992 2:182525554-182525576 ACATGACCACAGCAGGAGGATGG - Intergenic
943079694 2:183243675-183243697 ACACTGAAAAAGAAGGAGCAAGG - Intergenic
944043687 2:195384383-195384405 ACACAGCGAAAGCAGGAGCAAGG + Intergenic
944479890 2:200145655-200145677 ACATGGCCAAAGCAGGAAGGAGG + Intergenic
944491383 2:200261781-200261803 ACATGGTCAGAGCAGGAGGAAGG - Intergenic
944655163 2:201870213-201870235 AAATGGGCAAAGAAGGAAAAAGG + Intronic
944888466 2:204090096-204090118 ACATGACCAAAGATGGTGAAAGG + Intergenic
945479292 2:210325385-210325407 ACATGGCTAAATAAATAGCAAGG + Intergenic
946979916 2:225199271-225199293 AGATGGTCAAGGAAGGAGGAAGG - Intergenic
947270883 2:228333570-228333592 ACATGGCTAGAATAGGAGCAAGG - Intergenic
947271756 2:228343940-228343962 ACATGTCTAAGGAAGGAGGAAGG - Intergenic
947413787 2:229871528-229871550 ACATGGCAAGAGTGGGAGCAAGG - Intronic
947805820 2:232967185-232967207 ACATGGCAGGAGCAGGAGCAAGG - Intronic
947946350 2:234106202-234106224 ACATTGCAAAAGAAGGTGGAAGG - Intergenic
948029965 2:234809453-234809475 ACATGGCCAAAGCAGGCTCCCGG + Intergenic
948276079 2:236709794-236709816 ACACGGCAAAAGCAGGGGCAAGG - Intergenic
948604339 2:239125319-239125341 ACTTGGCAAGAGCAGGAGCAAGG - Intronic
948710613 2:239822740-239822762 ACATGGCCGGAGAGGGAGGAAGG - Intergenic
949037268 2:241821594-241821616 ACATGGCGAAAGCAGCAGCAAGG - Intergenic
949058845 2:241944980-241945002 CCATGGCCAGGGAAGGACCAAGG + Intergenic
949065649 2:241988829-241988851 ACATTTCCAAAGAAAGAGTAGGG + Intergenic
1168895734 20:1322180-1322202 AGTTGGCCAAGCAAGGAGCAGGG - Intronic
1169291324 20:4355551-4355573 ACATGGCTAGAGCAGGAGCAAGG - Intergenic
1169524470 20:6408370-6408392 ACTTGACAAAAGCAGGAGCAAGG - Intergenic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1169880274 20:10340140-10340162 ATATGGCAAGAGCAGGAGCAAGG + Intergenic
1170015410 20:11775738-11775760 ACATGGCCAAGGCAGGAGGAAGG - Intergenic
1170442371 20:16391740-16391762 TCATGGCCCAAGAGGGAGCTAGG + Intronic
1170714339 20:18818956-18818978 ACATGGCCAAAGAAGGAGCAAGG + Intronic
1170861690 20:20110367-20110389 ACATTCACAAACAAGGAGCAGGG + Intronic
1170984766 20:21247426-21247448 ACATGGCCAAAGAATGATCTTGG + Intergenic
1171194378 20:23186114-23186136 GCAGGGCCACAGAAGGAGAAGGG - Intergenic
1171451505 20:25239142-25239164 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1172226442 20:33308100-33308122 ACATGGCCCAAGCAGGAGCAAGG + Intronic
1172435145 20:34923678-34923700 ACATGGCAAGAGAGGAAGCAAGG + Intronic
1173399174 20:42709430-42709452 ACATGGCAAGAAAGGGAGCAAGG - Intronic
1173466805 20:43289766-43289788 AAAATGCCAAAGAAGGAGAAAGG - Intergenic
1173909738 20:46657805-46657827 ACATGTCCAGAGCAGGAGCAAGG + Intronic
1174086249 20:48010008-48010030 ACATGTCCAGAGAAGGAGGAAGG + Intergenic
1174123259 20:48283350-48283372 ACATGGTGAGAGAAGGAGCAAGG + Intergenic
1175096982 20:56548969-56548991 ACATGGCCAGAGGAGGAGCAAGG - Intergenic
1176291904 21:5050230-5050252 AAATGGCCACAGCAGGAGTATGG + Intergenic
1176592953 21:8660082-8660104 GCATGGCCAAAAACAGAGCAGGG - Intergenic
1176674043 21:9760580-9760602 ACATGGAGAAAGTAGGAGGAAGG - Intergenic
1177342272 21:19819003-19819025 ATATGGCAAAAGCAGGAGCATGG - Intergenic
1177789717 21:25709785-25709807 ACATGGCAAAAGCAGGAGCAAGG + Intronic
1178392260 21:32208424-32208446 ATATGGCCAAAGCAGAAGCAAGG - Intergenic
1178729211 21:35083646-35083668 ACATGGCAAGAGAAGAAGAATGG - Intronic
1178815171 21:35922944-35922966 ACATAGCAAAAGAAGGACAAAGG - Intronic
1179330605 21:40397401-40397423 ACACGGTGAAAGCAGGAGCAAGG - Intronic
1179396303 21:41043482-41043504 ACATGGCCAGAGCAGAAGGAAGG + Intergenic
1179402888 21:41100457-41100479 ACATGGCCAGAGCAAGAGGAAGG - Intergenic
1179865353 21:44213411-44213433 AAATGGCCACAGCAGGAGTATGG - Intergenic
1180275805 22:10637225-10637247 GCATGGCCAAAAACAGAGCAGGG - Intergenic
1180457249 22:15520899-15520921 ACATGGCAAGAGAGGGAGAAAGG - Intergenic
1181354213 22:22289112-22289134 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1182979024 22:34650720-34650742 GCTTGGCCAGAGCAGGAGCAAGG + Intergenic
1183222347 22:36523812-36523834 ACAGGACCAAAGCAGGAGGATGG - Intronic
1183589944 22:38774215-38774237 AAATGGCCAATGAAGCAGCCTGG - Intronic
1184710937 22:46249174-46249196 CCATAGTCAAAGAAGGAGCTGGG - Intronic
1184897633 22:47420802-47420824 ACATGGACTCAGAAGGACCAAGG - Intergenic
1184899610 22:47436758-47436780 ACATGGCAAAAGAGGGAGGAAGG - Intergenic
1184992205 22:48178471-48178493 ACATGGCCTAAGAAAGTGCAAGG + Intergenic
1185209687 22:49563723-49563745 ACATGGCGAAAGCAGAAACAAGG + Intronic
949693396 3:6666725-6666747 ACATGACAAAAGCAGGAGAAAGG - Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950523794 3:13511680-13511702 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
951810017 3:26688587-26688609 ACATGGCCAGAGCAGGAAGAAGG + Intronic
951937163 3:28034251-28034273 ACATGGCCAGAGCAGGATAAAGG - Intergenic
952126531 3:30307006-30307028 ACATGGCGAGAGAGGGAGGAAGG + Intergenic
952253293 3:31674654-31674676 ACATGGCAAGAGCAGAAGCAAGG - Intronic
952501000 3:33961910-33961932 ACATGGTGAAAGCAGGAGCAAGG + Intergenic
952637733 3:35552236-35552258 ACATGGCCAGAGCAGGAAGAAGG + Intergenic
952918234 3:38265957-38265979 ACATGGGCAAAAAAGTAGAAGGG - Exonic
953693404 3:45139013-45139035 ACATAGCAAGAGAAGAAGCAAGG + Intronic
954476036 3:50746734-50746756 ACATGGCAAGAGCAGGAGTAAGG + Intronic
954504077 3:51051845-51051867 ACATGGCAAGAGTGGGAGCAAGG + Intronic
954629466 3:52040229-52040251 AACTGGCCACAGTAGGAGCAGGG - Intergenic
954689111 3:52386459-52386481 CCAGGGCCCAAGTAGGAGCATGG + Intronic
954760207 3:52868304-52868326 ACATGGCCACACCAGCAGCAGGG - Intronic
956311207 3:67882596-67882618 ACAAGGCAAAAGCAGTAGCAAGG - Intergenic
957444411 3:80296425-80296447 ACATGGCAAGAGAGGAAGCAAGG + Intergenic
957691471 3:83576446-83576468 ACATGATGAGAGAAGGAGCAAGG + Intergenic
957899773 3:86474112-86474134 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
957914300 3:86666997-86667019 ACATGGCAGGAGCAGGAGCAAGG - Intergenic
958690936 3:97465397-97465419 ACATGGCTTAAGGAGAAGCAGGG + Intronic
959105110 3:102056975-102056997 AAATGGCCAGAGCAGGAGAAAGG + Intergenic
959992879 3:112648014-112648036 AAACGGCCAAAGAAGTAACATGG - Intronic
960011614 3:112840375-112840397 ACATGGCCAGAGCAGGAGGAAGG + Intronic
960216445 3:115043999-115044021 ACATGGCAAAAGCAGGAGCAAGG - Intronic
960429926 3:117556788-117556810 ACATGGCCAGACCAGGAGGAAGG - Intergenic
961049741 3:123736389-123736411 AGAGGGACAAAGAAGGAGGAAGG + Intronic
962141350 3:132793877-132793899 ACATGGCAAGAGGGGGAGCAAGG + Intergenic
962472487 3:135724099-135724121 ATATGGCCAGAGCAGGAGGAAGG - Intergenic
962507880 3:136066654-136066676 ACTTGGCGAGAGCAGGAGCAAGG + Intronic
962554510 3:136533564-136533586 ACATGGTGAGAGAAGGAGCAAGG + Intronic
962621002 3:137178840-137178862 ACATGGCCAAAGGAGTAGAAGGG + Intergenic
963223666 3:142838442-142838464 ACATGGCCAGAGTAGAAGCAAGG - Intronic
963574675 3:147045337-147045359 ACATGGCAAGAGCAGGAACAAGG + Intergenic
963903444 3:150754328-150754350 ACATGGCAAGAGCAGGAGCAAGG + Intronic
964729563 3:159850711-159850733 ACGTGGCCAGAGCAGGAGGAAGG + Intronic
964817521 3:160732412-160732434 ACATGACCAAAGCAGGAGGAAGG - Intergenic
964831842 3:160892306-160892328 ACATGGCGAGAGCAGGAGCAAGG + Intronic
965086319 3:164103501-164103523 ACATGGCCAAAGAAGGAGCACGG - Intergenic
965320326 3:167245696-167245718 ACATGGCCAGAGCAGGAGGAAGG - Intronic
965440028 3:168700789-168700811 TCATGGCAAAAGAAGCAGCCAGG + Intergenic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
966164985 3:177007036-177007058 ACATTGTGAAAGCAGGAGCAAGG - Intergenic
967170096 3:186816471-186816493 ACGTGGCGAAAGCAGCAGCAAGG + Intergenic
967883485 3:194317762-194317784 ACATGGCAAGAGTAGGAGCAAGG + Intergenic
968022493 3:195405845-195405867 ACATGGCCAGAGCAGGAGCCAGG + Intronic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
969938727 4:10708829-10708851 ACAGTGTCACAGAAGGAGCACGG + Intergenic
969939257 4:10713771-10713793 ACATGATGAGAGAAGGAGCAAGG - Intergenic
969949672 4:10822416-10822438 AAATGCCCAAAGCATGAGCATGG - Intergenic
970052948 4:11936881-11936903 ACATGGTGAGAGAGGGAGCAAGG + Intergenic
970402745 4:15733656-15733678 ACATGGCCAGAGAAGGAGGAAGG + Intronic
970487720 4:16541323-16541345 ACATGGAGAATGCAGGAGCAAGG - Intronic
970572716 4:17398544-17398566 ACATGGTAAAAGCAGGAGCAAGG + Intergenic
971051254 4:22865207-22865229 ACATGGCCAAAGATGGAGTCAGG - Intergenic
971265710 4:25094586-25094608 ACATGGTGAAAGCAAGAGCAAGG - Intergenic
971568927 4:28184900-28184922 CCATGGCCAGAGCAGTAGCAAGG - Intergenic
971582291 4:28357262-28357284 AGATGGGCAAAGAAGGAGATGGG + Intergenic
971700195 4:29962939-29962961 GCATGGCCAAAGAACCAGCCTGG - Intergenic
971748189 4:30611841-30611863 ACGTGGCCAGAGCAGGAGGAAGG - Intergenic
971864682 4:32154301-32154323 ACGTGGCAGGAGAAGGAGCAAGG - Intergenic
972254506 4:37338788-37338810 ACATGTCCAGAGAAGGAGATTGG - Intronic
972711355 4:41598586-41598608 ACATGGACAAAGAAGCAATAAGG + Intronic
973046495 4:45540467-45540489 ACATGGCAGAAGCAGGAGAAAGG - Intergenic
973154022 4:46925873-46925895 ATGTGGCCAAAGAATGAGAAAGG - Exonic
973337603 4:48972143-48972165 ACATGGCGGCAGGAGGAGCAGGG - Intergenic
973619819 4:52715069-52715091 ACATGGCCAGAGTAGGAGGAAGG - Intergenic
973976627 4:56269522-56269544 ACATGGCAAAAGCAGGAGCAAGG + Intronic
974209184 4:58747306-58747328 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
974511191 4:62843863-62843885 AGATGGCCAAAGAAGTTCCAAGG + Intergenic
975072538 4:70159587-70159609 ACATGGCCTCAGGAGGAGGAGGG - Intronic
975610008 4:76194088-76194110 ACATGGTGAAAGCAGGAGCAAGG - Intronic
976571469 4:86616679-86616701 ACATGGTGAAAGCAGGAGCAAGG - Intronic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
976847853 4:89510713-89510735 ACATGGCAAAAGAGGCAGCACGG - Intergenic
977115286 4:93016611-93016633 AGGTGTCCAAAGAAGGAGCAAGG + Intronic
977504903 4:97888945-97888967 ACATGGCTGAAGAAGGAGGAAGG - Intronic
977725918 4:100296729-100296751 ACATGGCAAAAACAAGAGCAAGG - Intergenic
977902478 4:102438163-102438185 ACATGGCGAGAGTGGGAGCAAGG - Intergenic
978421861 4:108541799-108541821 ACATGGTGAGAGCAGGAGCAAGG - Intergenic
978484068 4:109229991-109230013 ACATGGCAAAAGCAGGAGCAAGG + Intronic
978750626 4:112242584-112242606 ACACGGCAAAAGAGGAAGCAAGG + Intronic
979361753 4:119773615-119773637 ACATGGTCAGAGCGGGAGCAAGG + Intergenic
979561384 4:122105773-122105795 ACATGGGAAGAAAAGGAGCAGGG + Intergenic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
980705503 4:136488070-136488092 ACATGGCAAAAGCAAGAACAAGG + Intergenic
981477205 4:145198926-145198948 ACTTAGCCAGAGAAGGAGGAGGG - Intergenic
981677781 4:147359729-147359751 TCACTGCCAAAGAAAGAGCAGGG - Intergenic
981695055 4:147551504-147551526 ACGTGGCAAAAGCAGGGGCAAGG + Intergenic
982428990 4:155299712-155299734 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
983588064 4:169376575-169376597 ACACAGCCAAAGAAGTTGCATGG + Intergenic
983611949 4:169656347-169656369 ACATGGCCAGAGCAAAAGCAAGG + Intronic
983732456 4:171012341-171012363 ACATGGAAAAAGCAGGAGCAAGG + Intergenic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
984527766 4:180876861-180876883 GCATGGCAAGAGCAGGAGCAGGG - Intergenic
984812885 4:183810469-183810491 TCATTGCCAAAGAAAGAGCTGGG + Intergenic
984942230 4:184943063-184943085 ATATGGCGAGAGAGGGAGCAAGG + Intergenic
985764047 5:1767731-1767753 ACCAGGCCAGAGAAGGACCAGGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
987182339 5:15380856-15380878 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
987214326 5:15717266-15717288 ACATCGCCATAGGAGCAGCAGGG - Intronic
987220363 5:15784672-15784694 ACATGGTGAGAGCAGGAGCAGGG - Intronic
987243430 5:16024381-16024403 CCATGGCCAGAGCAGGAGCAAGG - Intergenic
987492420 5:18597634-18597656 ACATGGTAAAAACAGGAGCAGGG - Intergenic
987777398 5:22385837-22385859 ACATGGCCAGAGCAGGAGAAAGG + Intronic
988498131 5:31761992-31762014 ACATGGCTAATGCAGGAGGAAGG + Intronic
988671262 5:33384642-33384664 ACATGGCTGGAGAAGAAGCAAGG + Intergenic
988671463 5:33386207-33386229 ACACGGCTAGAGAAGGAGCAAGG + Intergenic
988915012 5:35883397-35883419 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
988928252 5:36010655-36010677 ACATGGTCAGAGTAGGAGAAAGG + Intergenic
989079099 5:37597642-37597664 ACATGGTGAAAGCAGCAGCAAGG - Intronic
989257300 5:39379585-39379607 ACATTGACAAAGTAGGGGCAAGG + Intronic
990318823 5:54609996-54610018 ACATGGTGAAAGTAGGAGTAAGG - Intergenic
990321271 5:54632203-54632225 ACATGGCCCAAGAGGTAGCAGGG - Intergenic
990578582 5:57147351-57147373 AAATGGCCAAAGAAGTAGGATGG + Intergenic
991136456 5:63187360-63187382 ACATGGGGAAAGCAGGAGCAAGG + Intergenic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
991441084 5:66650032-66650054 ACATGGTCCAAGTTGGAGCATGG - Intronic
994259282 5:97637908-97637930 ACATGGTGAAAGAAGTATCAGGG + Intergenic
994546871 5:101177652-101177674 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
994584602 5:101690533-101690555 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
994992893 5:107019923-107019945 ACACAGCCAAAGCAGGAGGAAGG + Intergenic
995283699 5:110363129-110363151 ACATGGTAAAAGCAGGAGCAAGG + Intronic
995561676 5:113388585-113388607 ACATAGCAAGAGAGGGAGCAAGG - Intronic
995648988 5:114346133-114346155 ACATGGCCAAAGCAGGAATTGGG + Intergenic
995782189 5:115789308-115789330 ACATGGCGAGAGAGGGAGCAAGG - Intergenic
995913176 5:117212406-117212428 ACATGGCAAGAGAAGAGGCAAGG + Intergenic
996126328 5:119729010-119729032 ACATGGCCAGAGCAGGAGGGTGG - Intergenic
996993614 5:129667609-129667631 ACATGGGGAGAGAGGGAGCAAGG - Intronic
997283901 5:132664924-132664946 ACATTGCCAAAGACAGAGGAAGG + Intergenic
997457031 5:134025245-134025267 ACATGGCGAAAGAGGGAGCATGG + Intergenic
998072087 5:139205856-139205878 ACATGGCAAAAGCAGGAGCAAGG - Intronic
998235995 5:140399617-140399639 ACATGACCAAAAAAGGAGTCTGG - Intergenic
998251358 5:140555536-140555558 AAATGGCCAAAGAAGAAAAAAGG - Intronic
998294193 5:140951518-140951540 ACATGGCCGGTGCAGGAGCAAGG + Intronic
998809770 5:145954843-145954865 ACATAGTGAAAGCAGGAGCAAGG + Intronic
999104395 5:149057769-149057791 ACATGGCTAATGAAGAAGCCAGG - Intronic
999906020 5:156142155-156142177 ACATGACCAGAGCAGGAGGAAGG - Intronic
1000139989 5:158393615-158393637 ACATGGCCCAAGCATGAGCCTGG - Intergenic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1000767531 5:165310322-165310344 ACATGGCCAGAGCAGAAGCAAGG - Intergenic
1001026153 5:168225992-168226014 ACAGGGCCAGAGAAAGAGCTGGG - Intronic
1001132229 5:169073724-169073746 ACATGGCAAGAGAAGAAGCAAGG - Intronic
1001471429 5:172015925-172015947 ACATGGCCCTAGAAGCTGCAGGG + Intergenic
1001981253 5:176038671-176038693 AACTGGCGAAAAAAGGAGCAAGG - Intergenic
1003131959 6:3402375-3402397 ACAAAGCCAAGGAAGGAGGATGG - Intronic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1003976787 6:11352101-11352123 ACGTGGCCCATGAAAGAGCAGGG - Intronic
1004101891 6:12621117-12621139 AAATGGCCAAAAAAATAGCAAGG + Intergenic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1004278638 6:14259683-14259705 ACATAACCAAAGAAGGGGCTGGG - Intergenic
1004488327 6:16089340-16089362 ACGTGGCTAAAGCAAGAGCAAGG + Intergenic
1004565306 6:16790380-16790402 ACATGGCCAGGGAAGGAGCAAGG + Intergenic
1005188972 6:23196370-23196392 ACAAGGCAAAAGCAGGAGCAAGG - Intergenic
1005571247 6:27147502-27147524 ATAAGGCCAAATAAGGAGCGAGG + Exonic
1005597759 6:27395376-27395398 ACATAGGGAAAGCAGGAGCAAGG - Intronic
1006020118 6:31112776-31112798 ACCTGGGCCAAGAAGGGGCAGGG - Intergenic
1006576819 6:35052730-35052752 ACATGGCCAGAGAAAGAGATGGG + Intronic
1006731335 6:36238581-36238603 ACATGGCCAAAGCAGGAGGAAGG + Intergenic
1007319518 6:41017475-41017497 ACAGGGCCAGAGTAGGACCAAGG + Intergenic
1008553394 6:52654802-52654824 ACATGGCAAAAGCAGGAGCAAGG - Intergenic
1008976846 6:57437118-57437140 ACATGGCAGGAGCAGGAGCAAGG + Intronic
1009037819 6:58139193-58139215 ACATGGTGAGAGAAGCAGCAAGG - Intergenic
1009164988 6:60330063-60330085 ACATGGCAGGAGCAGGAGCAAGG + Intergenic
1009213605 6:60892830-60892852 ACATGGTGAGAGAAGCAGCAAGG - Intergenic
1009596107 6:65738859-65738881 ACATGGCCAGAGCAGGAAGATGG - Intergenic
1009978555 6:70700164-70700186 ATATGGCGAGAGAAGGAGCAAGG - Intronic
1010449296 6:75984852-75984874 ACATGGCAAGAGTGGGAGCAAGG - Intronic
1010572898 6:77499465-77499487 ACATGGCAGAAGGAGGAGGAAGG + Intergenic
1011078230 6:83461010-83461032 ACATGGCAAGAGAAGGAGTGAGG - Intergenic
1011245730 6:85319080-85319102 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
1011694915 6:89903654-89903676 ACATGGTGAAAGCAGGAGCGAGG + Intergenic
1011898522 6:92262288-92262310 ACATGGTGAGAGAGGGAGCAAGG - Intergenic
1011955075 6:93016235-93016257 ATATGCCCAGGGAAGGAGCAAGG - Intergenic
1012174496 6:96063390-96063412 ACATGGCAAAAGCAGGAACAAGG + Intronic
1012258646 6:97062317-97062339 GCATGGCCTAAGGAGGAGAATGG - Intronic
1013088212 6:106874943-106874965 ACATGGCCAGAGAAGAAGTAAGG + Intergenic
1013146097 6:107394419-107394441 ACATGGCAAAAGCAGGAGCAGGG + Intronic
1013662552 6:112312554-112312576 ACAAGGGCAATTAAGGAGCAGGG - Intergenic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1014719753 6:124901909-124901931 ACATGGCAAAAGCAGGAGCAGGG + Intergenic
1015264621 6:131278637-131278659 ACACGGCCAGAGCAGGAGGAAGG + Intronic
1015390702 6:132678325-132678347 ACATGGCAAAAGCAGGAGCGAGG + Intergenic
1015421789 6:133019411-133019433 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1015672564 6:135706788-135706810 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
1016054539 6:139565676-139565698 ACATGGCCAGAGCAGGAGGAGGG + Intergenic
1016060403 6:139623869-139623891 AGGTGGCCAAAAAAGGAGTAAGG + Intergenic
1016372769 6:143391952-143391974 ACGTGGCAAAAGCAGGAGCAAGG - Intergenic
1017314914 6:153019645-153019667 ACATGGGCAAAGCAGGAGCAAGG - Intronic
1017350119 6:153430530-153430552 ACATGGCAAGGGAGGGAGCAAGG - Intergenic
1017401727 6:154072076-154072098 CTATTGCCAAAGAAGGAGAAGGG - Intronic
1017637159 6:156454823-156454845 ACATGGACAAAGCAGAAACAAGG + Intergenic
1018442306 6:163824472-163824494 ACATGGACAAAGATGCTGCATGG + Intergenic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1018564569 6:165137626-165137648 ACATGGCCAGAGCAAGAGGAAGG - Intergenic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1018645184 6:165941642-165941664 ACATGGCAAAAGCAGGAGCAAGG - Intronic
1018766380 6:166936565-166936587 ACATGGCCAGAGAGGAAGCCAGG + Intronic
1019106885 6:169675301-169675323 ATATGGCAAAAACAGGAGCAAGG - Intronic
1019826296 7:3287116-3287138 ACATGGTGAAATCAGGAGCAAGG - Intergenic
1019889229 7:3932732-3932754 ACAAGGCCACAGAACGAGCCAGG - Intronic
1020198903 7:6063913-6063935 ACATGGCCAGAGAAGAAGAAAGG - Intergenic
1020470381 7:8527851-8527873 AGATGGGAAAAGAAGGAACATGG + Intronic
1020590794 7:10134144-10134166 ACATGGCTGGAGAAGGAGCAAGG - Intergenic
1020813715 7:12877859-12877881 AGATTTCCAAAGAAGGAACATGG - Intergenic
1021453672 7:20805872-20805894 ACATGGCCAGAGCAGGAACAAGG + Intergenic
1021758684 7:23881943-23881965 ACATGGCCAGAGCAGGAGGAAGG + Intergenic
1021758765 7:23882622-23882644 ACATGCCCAGAGCAGGAGGAAGG + Intergenic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1022800524 7:33772643-33772665 ACATGGCCAGAGGAGGAGGAAGG - Intergenic
1023989718 7:45121461-45121483 AGATGGGCAAAGAAGGCACAAGG - Intergenic
1024059809 7:45689474-45689496 ACATGGCGAGAGCAGGAGCAAGG + Intronic
1024188808 7:46983991-46984013 ACATGGACAAAGAAGGGGAAAGG + Intergenic
1024533157 7:50409745-50409767 ACATGGCCAAGACAGGAACAAGG + Intergenic
1024618082 7:51132801-51132823 ACATGGTGAGAGAGGGAGCAAGG + Intronic
1025605375 7:63036646-63036668 ACATGGCGAAAGTAGGAGGAAGG - Intergenic
1025822065 7:64973700-64973722 ACATAGAAAAAGAAGGAGAAGGG + Exonic
1026358977 7:69585389-69585411 ACATGGCAACAGTGGGAGCAAGG - Intergenic
1027395118 7:77746326-77746348 ACATGGCCAGAGCAGGAGAGAGG + Intronic
1027491674 7:78834878-78834900 ACACGGTGAAAGCAGGAGCAAGG - Intronic
1028092933 7:86725845-86725867 ACATGGCAGAAGAAGGGGGAAGG + Intronic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1028257182 7:88613583-88613605 ATATGGCCAAAGCAGGAAGAAGG + Intergenic
1028634517 7:92972236-92972258 AAATAGCAAAAGCAGGAGCAAGG + Intergenic
1028746124 7:94328655-94328677 AGATGGCAAAATCAGGAGCAAGG + Intergenic
1028792193 7:94865550-94865572 ACATGGCAAGAGTGGGAGCAAGG - Intergenic
1028844468 7:95463591-95463613 ACATGGCCAGAGCAGGAGGAAGG - Intergenic
1028954633 7:96674933-96674955 CCATGGAGGAAGAAGGAGCAGGG + Intronic
1029036180 7:97524661-97524683 AAATGGCAAGAGAGGGAGCAAGG + Intergenic
1029971859 7:104797486-104797508 ACATCCCCAAATGAGGAGCATGG + Intronic
1030070514 7:105693928-105693950 CCAAGACCAAGGAAGGAGCAGGG + Intronic
1030085221 7:105810172-105810194 AGATGGCAAAAGATGGGGCAGGG + Intronic
1030162758 7:106525558-106525580 AGAGCGCCAGAGAAGGAGCATGG + Intergenic
1030648820 7:112094852-112094874 GCATGGTGAAAGCAGGAGCAAGG - Intronic
1030989425 7:116282122-116282144 ACATGACTAAAAAAAGAGCAAGG - Intergenic
1031261900 7:119532081-119532103 ACATGGCAAAAGCAGAAACAAGG - Intergenic
1031362769 7:120866906-120866928 ACACGGTGAAAGCAGGAGCAAGG - Intergenic
1031429650 7:121651336-121651358 ACATGGCTGGAGCAGGAGCAAGG - Intergenic
1031654387 7:124334369-124334391 ACATGGCCAAAAGAAGAGAAGGG + Intergenic
1031762665 7:125734156-125734178 ACTTGGAAAAAGCAGGAGCAAGG + Intergenic
1033063299 7:138128605-138128627 ACATGGCCCAGGCAGGAGCAAGG + Intergenic
1034166888 7:149032103-149032125 AGATGGAGAAAGAAGGAGCCAGG + Intergenic
1035014952 7:155757853-155757875 TCATGGCAAAAGCAGGAGCATGG + Intronic
1035438355 7:158876182-158876204 ACAGGGCCAGAGCAGGAGGAAGG + Intronic
1036096430 8:5729396-5729418 ACATGGCAGAAAAATGAGCAGGG + Intergenic
1036565964 8:9938306-9938328 GCAAGGTCAAAGATGGAGCATGG - Intergenic
1036609983 8:10341321-10341343 ACATGGTGAAAGCAGGAGCAAGG + Intronic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037392872 8:18413035-18413057 ACTTGGCAAAAGTAGGAGGAAGG - Intergenic
1037918653 8:22788305-22788327 AGGGGGACAAAGAAGGAGCAGGG + Intronic
1038246986 8:25867499-25867521 ACATGGCCAAAGAGGTAGGAAGG - Intronic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1038370582 8:26985894-26985916 ACATGATCAGAGCAGGAGCAAGG + Intergenic
1039226115 8:35390116-35390138 ACATGGCCAGAGGAGAAGCAAGG + Intronic
1039671430 8:39604614-39604636 ACATGGCAAAAGCAGAAGCAAGG - Intronic
1039710321 8:40049647-40049669 TCATGGCAAAAGCTGGAGCAAGG - Intergenic
1040045649 8:42961036-42961058 ACATGGCAAGAGTAGGAGCAAGG + Intronic
1040871784 8:52107166-52107188 ACATGGCGACAGAGGAAGCAGGG + Intergenic
1042111973 8:65390491-65390513 GCATGGCCGAAGCAGGAGAAAGG + Intergenic
1043533498 8:81175580-81175602 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1044264493 8:90166018-90166040 ACCTGGGCAATGAAGGAGCTGGG - Intergenic
1044497334 8:92902437-92902459 ACATGGCCAAAGGTGAAGTACGG + Intronic
1045169365 8:99646816-99646838 ACATGGGGAGAGAGGGAGCAAGG - Intronic
1045209012 8:100075354-100075376 ACATGGCAAGAGAGGTAGCAAGG - Intronic
1045239936 8:100391365-100391387 GCATGGCCAGAGAAGCAACATGG - Intronic
1045266507 8:100623200-100623222 ACATGGCTGGAGCAGGAGCAAGG + Intronic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046190166 8:110784819-110784841 ACATGGTGAGAGAAGAAGCAGGG + Intergenic
1046597278 8:116274982-116275004 ACATGTACAAAGAAGGTTCATGG + Intergenic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1047393205 8:124471053-124471075 ACATGGCAAAAACAGGAGCGAGG - Intergenic
1047426106 8:124748446-124748468 ACATGGCAAGAGCAGGAGGAAGG + Intergenic
1048115233 8:131514232-131514254 CTATGGCAAAAGCAGGAGCAAGG - Intergenic
1048169528 8:132092589-132092611 ACATGACTAGAGCAGGAGCAAGG - Intronic
1048318570 8:133380379-133380401 ACATGGCCAGAGCAAGAGGAAGG - Intergenic
1048378657 8:133844917-133844939 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1048635575 8:136291827-136291849 ACATAGCCAGAGCAGGAGCAAGG + Intergenic
1049304155 8:141890669-141890691 ACATGGCAAAAGTGGGAGCAAGG + Intergenic
1050074690 9:1851529-1851551 ACATGGCGAGAGAGGGAGAAGGG - Intergenic
1051442241 9:17097892-17097914 ACATGGTGAAAGCAGGAGCAAGG + Intergenic
1052391355 9:27882021-27882043 ACATGACAAAAGGAGGAGGAAGG + Intergenic
1052719978 9:32162660-32162682 ACTTGGCAAAAGAAAGAGGAGGG - Intergenic
1053692503 9:40593324-40593346 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054272314 9:63044209-63044231 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1054303745 9:63394242-63394264 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054402523 9:64720752-64720774 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054436133 9:65205083-65205105 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1054494259 9:65816604-65816626 GCAAGGCCAGAGAAGGACCATGG + Intergenic
1054961613 9:70976206-70976228 ACATGGGTCAAGAAGGAGCAAGG + Intronic
1055102842 9:72482859-72482881 GCATGGCGAAGGCAGGAGCAAGG - Intergenic
1055127132 9:72731811-72731833 ACATGGTCAAAGGAGTAGGAGGG - Intronic
1055561200 9:77523353-77523375 ACATGGCCAGAGCAGGAACAAGG + Intronic
1055663524 9:78531005-78531027 ACATGGCCAGAGCAGGAAGAAGG - Intergenic
1056003921 9:82247138-82247160 ACATGGCGAAAGCAGGAGCAAGG - Intergenic
1056011021 9:82330541-82330563 GCTTGGCAAAAGAAGGAGCGTGG + Intergenic
1056394102 9:86165888-86165910 ACATGGCAAAAGCAGGAACAAGG - Intergenic
1058341632 9:103904552-103904574 ACATGGCAAGAGAGAGAGCAAGG - Intergenic
1058851360 9:109014055-109014077 ACATGGTGAAAGAATGAGCAGGG - Intergenic
1059011660 9:110467957-110467979 ACGTGGAGAAAGTAGGAGCAAGG - Intronic
1060348922 9:122840419-122840441 ACATGGCAAGAGCAGGACCAAGG + Intergenic
1062271236 9:135710381-135710403 ACAAGGACAAATAAGGAACAAGG + Intronic
1203623001 Un_KI270749v1:138889-138911 GCATGGCCAAAAACAGAGCAGGG - Intergenic
1203623151 Un_KI270749v1:139401-139423 GCAAGGCCAGAGAAGGACCATGG - Intergenic
1186233657 X:7483879-7483901 ACACGGCTAAAGCAGGAGGAAGG - Intergenic
1186388365 X:9132995-9133017 ACATGGTGAAAGCAGGAGCAAGG + Intronic
1186391528 X:9164636-9164658 ACATGACCAGAGCAGGGGCAAGG + Intronic
1186626828 X:11303666-11303688 CCATGGCCAAATATGAAGCATGG - Intronic
1186679905 X:11861995-11862017 ACATGGCTGGAGCAGGAGCAAGG + Intergenic
1186850626 X:13576240-13576262 ACATGGCAAAAGCAGGAGCAAGG + Intronic
1187185268 X:16978470-16978492 ACAAGGGCACAGAAGGAGCATGG - Intronic
1187768333 X:22667779-22667801 ACATGGCTGGAGAAGGAGCGAGG - Intergenic
1187836377 X:23436060-23436082 AAATGGTTAAAGCAGGAGCAAGG - Intergenic
1188348093 X:29093316-29093338 ACATGGCCAGAGCAGGAGGAGGG + Intronic
1188504185 X:30863595-30863617 ATATGGCAAAAGCGGGAGCAAGG - Intronic
1188607163 X:32045380-32045402 ACATGGCCAGAGCAGAAGCCAGG - Intronic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1189720548 X:43911495-43911517 ACAAGGCAAAAGCAGCAGCAAGG - Intergenic
1189931707 X:46018974-46018996 TAATGGCCAAAGGTGGAGCAGGG - Intergenic
1190074407 X:47305657-47305679 ACATGGCAAAAAAAGGGGAAAGG - Intergenic
1190426669 X:50339771-50339793 ACATGGCAAAAGCAGGGGCAAGG + Intronic
1190600872 X:52090277-52090299 AGATGGCCAGAGAAAGAGGAAGG - Intergenic
1192265652 X:69535845-69535867 GCATGGGCAAGGAAGAAGCATGG + Intergenic
1192660794 X:73040356-73040378 ACATGGCCAGAGTAGGAAAAAGG + Intergenic
1193205332 X:78740958-78740980 ACATGGCCAGAGAGGAACCATGG + Intergenic
1193330027 X:80225334-80225356 ACATGGCAAAAGAGAAAGCAAGG + Intergenic
1193412806 X:81184287-81184309 ACTTGGCCAGAGCAGGAGCAAGG - Intronic
1193442791 X:81564126-81564148 ACATGGCCATAGTAGGAGCAAGG - Intergenic
1193758486 X:85437337-85437359 ACATGGCAAAACTGGGAGCAAGG - Intergenic
1194257665 X:91653985-91654007 ACATGGCTAGAGTAGGAGGACGG + Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1194360210 X:92941140-92941162 ACATTGTCAAAGCAGGAGGAGGG + Intergenic
1195690525 X:107620691-107620713 ACATGGCAAGAGCAGAAGCAAGG + Intergenic
1196541367 X:116912278-116912300 ACATGGTGAAAGCAGGAGCAAGG - Intergenic
1196780854 X:119382929-119382951 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
1197189905 X:123634716-123634738 ACAGGGACAAAGATGTAGCATGG + Intronic
1197608991 X:128617298-128617320 ACATGGCAAGAGTGGGAGCAAGG + Intergenic
1198187405 X:134266939-134266961 ACATGGCAAAAGCAGGAGAAGGG + Intergenic
1198273394 X:135077262-135077284 ACATGTTCAAAGAAGTAGAAAGG - Intergenic
1198627485 X:138593996-138594018 ACAAGGTCAGAGAAGGAGTAGGG + Intergenic
1198667808 X:139044339-139044361 ACATGGCAAAAGCAGGAGCAAGG + Intronic
1199038101 X:143077839-143077861 ACATGGTGAGAGCAGGAGCAAGG + Intergenic
1199331278 X:146562677-146562699 GAATGGCCAGAGAAGGAGAATGG + Intergenic
1199512566 X:148638686-148638708 ACGTGGCAAAAGAAGGAGCAAGG + Intronic
1199653253 X:149969217-149969239 GCCTGGACAAAGAAGCAGCATGG - Intergenic
1199738578 X:150709697-150709719 ACATGGCCAGAGTGGGAGCAAGG + Intronic
1200257711 X:154593446-154593468 ACATGGCCAGGGCAGGAGCAAGG - Intergenic
1200473171 Y:3611682-3611704 ACATGGACAGAGCAGGAGGAAGG - Intergenic
1200576322 Y:4892931-4892953 ACATGGCTAGAGTAGGAGGACGG + Intergenic
1200668413 Y:6056957-6056979 ACATTGTCAAAGCAGGAGGAGGG + Intergenic
1200740763 Y:6851208-6851230 CCATGGCCAAAAATGAAGCATGG + Intergenic