ID: 1170715488

View in Genome Browser
Species Human (GRCh38)
Location 20:18827633-18827655
Sequence CTTTATAAGCAGAGGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 11, 2: 36, 3: 97, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170715488 Original CRISPR CTTTATAAGCAGAGGAAGAG AGG Intronic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901566449 1:10119777-10119799 CTTTAGAAGATGAGGAAGAAAGG - Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
902539134 1:17140164-17140186 CTTTATAAGAAAAGCAAGAGAGG - Intergenic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
905277850 1:36830504-36830526 CCGTATAAGAAGAGGAAAAGAGG + Intronic
905288278 1:36901675-36901697 CTTGAAAAGCAGTGGGAGAGGGG - Intronic
907289168 1:53401973-53401995 CTTTATAAAAAGAGGAAATGTGG + Intergenic
907700097 1:56777752-56777774 CATTATAAGCAGATGAAACGTGG - Intronic
907703522 1:56813212-56813234 CTTTATTAGCAGCGTAAGAACGG - Intronic
907718126 1:56946802-56946824 CTGTATAGGCAGAGAAAAAGAGG + Intronic
907740150 1:57157609-57157631 CTTTGTAAGAAGAGGAAAGGAGG - Intronic
907814262 1:57902878-57902900 CTTTATTAGCAGTGTGAGAGTGG - Intronic
908890678 1:68844108-68844130 CTTTATAAGGAGAGGAAATTAGG + Intergenic
909050685 1:70764228-70764250 CATGATAAGCAGAGAAGGAGAGG + Intergenic
909489573 1:76211022-76211044 CCCCATAAGAAGAGGAAGAGAGG - Intronic
909567981 1:77077146-77077168 CTTTATTAGCAAAGTAAGAGTGG - Intergenic
910104437 1:83616300-83616322 CTCTATAAGCAAAGGGAGTGGGG - Intergenic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
910489895 1:87757199-87757221 CTTTATAAGCATAGGCCTAGTGG - Intergenic
911855431 1:102870034-102870056 CTTTATCAGCAGTGTAAGAAAGG - Intergenic
912056007 1:105598430-105598452 CTTTATTAGCAGCATAAGAGTGG + Intergenic
912323227 1:108734057-108734079 CTTTTTAGGAAGGGGAAGAGTGG - Intronic
914237817 1:145828139-145828161 CATTGTAAGCAAAGCAAGAGAGG + Intronic
914433897 1:147643040-147643062 CCTTATAAGAAGAGGAAATGAGG - Exonic
915074213 1:153295544-153295566 TTATGTAAGCAGGGGAAGAGTGG - Intergenic
915193233 1:154169434-154169456 TTTCAGAAGCAGATGAAGAGAGG + Intronic
915196278 1:154192363-154192385 TTTTAAAAGAAGAGGAAGAGGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916323195 1:163529092-163529114 CTTAATAAGAAGATGAAGAGAGG + Intergenic
916900330 1:169215292-169215314 CTTTATAGGCACAGGATGGGGGG + Intronic
917313572 1:173702453-173702475 GTTTATAAGGAGAAGAAAAGAGG + Intergenic
918432139 1:184472233-184472255 CTTTTTAATCAGAAGAAGAAAGG + Intronic
918897643 1:190368088-190368110 CTTTATTAGCAGTGTAAGAATGG - Intronic
919979307 1:202632465-202632487 CTCTATAACCAGTGGAAGAAAGG + Intronic
920446926 1:206024710-206024732 CCTTATAAGAAGAGGAAATGTGG - Intergenic
920784177 1:209024679-209024701 CTTTATTAGCAGAGTAAGAATGG + Intergenic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
921278654 1:213544076-213544098 GATGATAAGCAGAGGAGGAGGGG + Intergenic
921337315 1:214101198-214101220 CTTTATAAGAGGAGGAAATGTGG - Intergenic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
922643002 1:227254914-227254936 CAATATAAGCAAATGAAGAGAGG + Intronic
922786365 1:228284355-228284377 CTTTAAAAGAAGATGAAGAGAGG - Intronic
923001329 1:230008645-230008667 CTTTAAAAGAAGAGAAACAGGGG - Intergenic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
923757894 1:236810059-236810081 CTTCATAAAAATAGGAAGAGAGG + Intronic
923774920 1:236969597-236969619 TTTTATAAGAACAGGAAGAGAGG + Intergenic
924277977 1:242407332-242407354 CTTTATTAGCAGTGTAAGAATGG + Intronic
924372106 1:243361695-243361717 CTGGTTAAGCAAAGGAAGAGTGG - Intronic
1063753296 10:8976763-8976785 CTAGATATGCAGAGTAAGAGTGG + Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064221143 10:13441040-13441062 CTTCATAAACACAGGAAGACCGG + Intronic
1064651677 10:17516001-17516023 CCTTATAAAAAGAGGAAGGGAGG - Intergenic
1064710546 10:18119415-18119437 CTTTATTAGCAGCGTAAGAATGG + Intergenic
1064836214 10:19533920-19533942 CATTTAATGCAGAGGAAGAGAGG + Intronic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1065825517 10:29567124-29567146 TCTTAGAAGCAGAGGAAGGGGGG - Intronic
1065909280 10:30287289-30287311 CTTTGTAGGCACAGGATGAGGGG + Intergenic
1067852080 10:49760704-49760726 CTTTATAAACAGAGAAACTGAGG + Intronic
1068015947 10:51516362-51516384 CTTTATAGGCACAGGATGGGAGG + Intronic
1068819484 10:61357311-61357333 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1070507219 10:77124822-77124844 CTTTATTAGCAGAGTGAGAACGG - Intronic
1071018754 10:81028135-81028157 CAATCTATGCAGAGGAAGAGTGG - Intergenic
1071068789 10:81667820-81667842 CCTAATAGGCAGAGGAATAGTGG - Intergenic
1071436645 10:85653742-85653764 TTTTATAAGGAGAAGAAGAGAGG + Intronic
1071908119 10:90197552-90197574 ATTTGTAAGCAGATGAAGTGTGG + Intergenic
1071934059 10:90507093-90507115 TTCTATAAGCCAAGGAAGAGAGG + Intergenic
1072537959 10:96377615-96377637 CTTTCTAAGCAGTGGTAGACTGG - Intronic
1072652038 10:97303393-97303415 CTTTACAAGAAGAGGAAGAGAGG + Intergenic
1072838279 10:98740581-98740603 CTTTCAAAGAAGAGGAAAAGAGG + Intronic
1076292114 10:129353563-129353585 TTTTGTGAGTAGAGGAAGAGGGG - Intergenic
1076326637 10:129628820-129628842 CTTCAGAAGCAAGGGAAGAGGGG - Intronic
1076880665 10:133237812-133237834 GTTTATAAGCCCAGGAGGAGGGG - Exonic
1077388148 11:2285094-2285116 CTCAGAAAGCAGAGGAAGAGAGG - Intergenic
1078550992 11:12280607-12280629 CTTTCTAAGAAGAGGAAATGTGG - Intronic
1078665920 11:13325101-13325123 CTTTATAAGAAAAGCAGGAGGGG + Intronic
1078835015 11:15018590-15018612 CTTTATTAGCAGTGTGAGAGTGG + Intronic
1079663979 11:23080648-23080670 TTCTATAAGAAGAGAAAGAGGGG - Intergenic
1080768712 11:35320938-35320960 CTTTATTAGCAGAGTGAGAATGG - Intronic
1081507360 11:43732328-43732350 CTTTATCAGCAGCGTGAGAGTGG + Intronic
1081827914 11:46076005-46076027 CTTTCTAACCAGAGGGAGAGTGG + Intronic
1082097125 11:48139946-48139968 CTAAAAAAGCAGAGTAAGAGGGG + Intronic
1082108030 11:48242112-48242134 CTTGATAAGCAGGGGGGGAGGGG + Intergenic
1082612591 11:55319550-55319572 CTTTATATGTAGAGTGAGAGTGG + Intergenic
1083107610 11:60373710-60373732 TTTTATAGGCACAGGAGGAGGGG - Intronic
1083700373 11:64473507-64473529 TCTTATAAGCAGAGGAAATGTGG - Intergenic
1084106174 11:66982157-66982179 ATTTTTAAACAGAGGAAGACAGG + Intergenic
1084227417 11:67725852-67725874 CTTAATATCCAGGGGAAGAGAGG + Intergenic
1084235049 11:67782368-67782390 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084346145 11:68550373-68550395 TTTTATGAGCAGAGGAGGGGTGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084727820 11:70953375-70953397 ATCTATAAGCTGGGGAAGAGAGG + Intronic
1084887435 11:72220284-72220306 CATTTTGAGCAAAGGAAGAGAGG - Intronic
1085475727 11:76787798-76787820 ATTTGTAAGCTGAGGCAGAGTGG + Intronic
1087575609 11:99985462-99985484 CTTTATAGGCACAGGATGATGGG + Intronic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088928103 11:114322567-114322589 CTTTATAATCATTAGAAGAGTGG + Intergenic
1089553764 11:119302910-119302932 CTGTATAAGAAGAGAAAGAGAGG - Exonic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090027842 11:123182898-123182920 GTTTATAAACTGAGGAAGAAAGG - Intronic
1090305939 11:125691140-125691162 CATGATAAACAGATGAAGAGAGG - Intergenic
1090990961 11:131816384-131816406 TTTTAAAAGCCGTGGAAGAGGGG + Intronic
1091523150 12:1268522-1268544 CTTTAGGAACAGAGGAAGAGGGG + Intronic
1093388892 12:18593112-18593134 CTTTATAAAAAGAGGAAATGTGG - Intronic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1093883654 12:24434889-24434911 CTTTATAAGCAGTGCAAGAATGG + Intergenic
1094032618 12:26030339-26030361 GTTTATAAGCCCAGGTAGAGGGG + Intronic
1094033664 12:26043177-26043199 CTTTGAAAGCACAGGGAGAGTGG + Intronic
1094298801 12:28937949-28937971 CTTTATAAACAAAGGAAAAGAGG - Intergenic
1095270029 12:40207601-40207623 CTTAATAAGCAAGGGAAAAGAGG - Intronic
1095527207 12:43141215-43141237 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1097074841 12:56385216-56385238 CTTTATAAGAAGAGAAATACTGG + Intergenic
1097433201 12:59532000-59532022 CTTTATATCCAGGGGAAGAGAGG + Intergenic
1097625303 12:61992735-61992757 TTTTACAAGAAAAGGAAGAGTGG - Intronic
1097747870 12:63318964-63318986 CTTTATAGGCACATGATGAGGGG + Intergenic
1098129971 12:67340049-67340071 CTTTATAAGGAAAGGGAGAAAGG + Intergenic
1099451262 12:82810184-82810206 CTTTAAAAGCATAGAAAAAGTGG + Intronic
1099533408 12:83816202-83816224 CCTTATAAGAAAAGGAAGAGAGG - Intergenic
1100365088 12:93912936-93912958 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1100405569 12:94270256-94270278 CTTTATAAAAATAGGCAGAGGGG - Intronic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1100979252 12:100151975-100151997 CTTTATAATCAGTAGAAGTGTGG - Intergenic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1102272992 12:111555662-111555684 CTTTATTAGCAGTGTAAGAATGG + Intronic
1102603239 12:114049270-114049292 CTTTATATGCAGAGCAAGGAAGG - Intergenic
1102892213 12:116568697-116568719 CTTTATGAGCAGAGGAGGAGAGG + Intergenic
1103070244 12:117935397-117935419 GGTTTTGAGCAGAGGAAGAGTGG - Intronic
1103131002 12:118468598-118468620 CTTTATGAGAAGAGGAGGAGAGG - Intergenic
1103157694 12:118700556-118700578 CTTTTCAAGCAGAAAAAGAGAGG - Intergenic
1104138959 12:125968288-125968310 CATTTTAAAAAGAGGAAGAGCGG + Intergenic
1104285119 12:127418063-127418085 CTTTATAGGCACAGGATTAGGGG - Intergenic
1105567889 13:21569392-21569414 CTCTATAAGCAGAGCATGAGAGG - Intronic
1105621042 13:22066310-22066332 CTTTATTCTCAGGGGAAGAGAGG - Intergenic
1106219649 13:27735030-27735052 CCTTATAAGAAGAGGAAATGGGG + Intergenic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1106772572 13:32975942-32975964 TTTTATACCCATAGGAAGAGAGG - Intergenic
1106819017 13:33442745-33442767 CATTAGAAGCAGAGGCATAGGGG + Intergenic
1106824061 13:33500046-33500068 TTTTGTAAGAAGAGGAAGCGTGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1106987994 13:35378445-35378467 CTTTATAAGCAGTGGCTAAGTGG - Intronic
1107514280 13:41113948-41113970 CTTTATAAGAAGAGGAGGCCCGG - Intergenic
1107588351 13:41876857-41876879 CATATTAGGCAGAGGAAGAGTGG - Intronic
1107649643 13:42531688-42531710 CTTTAGAAGAAGAGGGAGATGGG - Intergenic
1107675009 13:42786577-42786599 CTGTTTAAGCAAATGAAGAGAGG + Intronic
1107753484 13:43594494-43594516 TTGTTTAAGCTGAGGAAGAGGGG + Intronic
1108211344 13:48142773-48142795 CAATAGAAGCAGAGGCAGAGTGG - Intergenic
1108697324 13:52913935-52913957 CATGATTAGCAGAGGAAGACGGG - Intergenic
1109189376 13:59307098-59307120 CTTTATTAGCAGAGTGAGAGCGG - Intergenic
1109308375 13:60664161-60664183 GGTTATGAGCAGAGGAAGAGGGG - Intergenic
1111240364 13:85465797-85465819 CTTTATAAGCAATGCAAGAATGG - Intergenic
1111251934 13:85613054-85613076 CTCCATGAGCAGAGGAACAGAGG - Intergenic
1111357387 13:87126342-87126364 CTTTATCAGCAGCGTAAGAATGG + Intergenic
1111794143 13:92896163-92896185 CTTTTTAAGAAGAGGAAGAGAGG - Intergenic
1111971357 13:94920171-94920193 GTTTACAGTCAGAGGAAGAGAGG + Intergenic
1112996092 13:105576352-105576374 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1114871740 14:26666720-26666742 CTTTATCAGCAGTGTGAGAGTGG - Intergenic
1114914027 14:27239589-27239611 CTCTGAAAGGAGAGGAAGAGAGG - Intergenic
1115053157 14:29089614-29089636 CTTTATGAGCAGCGTAAAAGCGG + Intergenic
1116756994 14:48960607-48960629 CTTTATAGGAAGAGGTTGAGAGG + Intergenic
1116934431 14:50724548-50724570 TTTTTTAAGGAAAGGAAGAGAGG - Intronic
1118161531 14:63295561-63295583 CTCTAGAAGCACAGGAAGAAAGG + Intergenic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1118828308 14:69404863-69404885 CTTTATTAGCAGTGTAAGAATGG - Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119442654 14:74638669-74638691 TTTTATAGGCAGAGGAACTGAGG + Intergenic
1119885144 14:78134110-78134132 CCTTATAAAAAGAGCAAGAGAGG - Intergenic
1120181323 14:81345333-81345355 CTTTATAAGAAGAGGATGTTAGG + Intronic
1120324404 14:83007034-83007056 CCTTATAAGAGGAGGAAGAGAGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1120752901 14:88214795-88214817 CTTTTAAAGCAGATGAAGACAGG + Intronic
1120887454 14:89462983-89463005 CTTTTTAAGAAGAGGAAGAGAGG - Intronic
1121260721 14:92564227-92564249 ATTTATTTGGAGAGGAAGAGGGG + Intronic
1121278851 14:92685943-92685965 CTTCATATGCAGAGGATGATAGG - Intronic
1124242365 15:28039732-28039754 CCTTATAAGAAGAGGAAGTTTGG + Intronic
1124494905 15:30180421-30180443 CTCTATAACCAGTGGAAGAAAGG + Intergenic
1124719047 15:32096013-32096035 CTTTATAATCAAAGGAGAAGAGG - Intronic
1124721954 15:32118126-32118148 CTTGATAAGAAGAGGAAGAGAGG + Intronic
1124748662 15:32358224-32358246 CTCTATAACCAGTGGAAGAAAGG - Intergenic
1125071850 15:35564283-35564305 CTTTATAAGAAGAGAAAATGTGG - Intergenic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1125931854 15:43605775-43605797 CTTCACAAGCAGAGGAAGGGTGG - Intronic
1125944953 15:43705253-43705275 CTTCACAAGCAGAGGAAGGGTGG - Intergenic
1126957382 15:53948770-53948792 CCTTTCAAGCAGAGGAAAAGGGG + Intergenic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1127646746 15:60966167-60966189 CCTTATAAGAAGAGGAAATGTGG - Intronic
1127732021 15:61810556-61810578 ATTTAAAAGCAGGGAAAGAGAGG - Intergenic
1128785809 15:70396052-70396074 CTCTATTAGCAGAGGGAGACGGG + Intergenic
1129019639 15:72504602-72504624 CTTTATCTGCACAGGATGAGGGG + Intronic
1129509848 15:76113362-76113384 TTCCATAAGCAGAGGCAGAGAGG + Intronic
1129916695 15:79280373-79280395 CTTTATTAGCAGTGTGAGAGAGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1130318556 15:82818925-82818947 CTTTATTAGAAGAGAAAGAGAGG - Intronic
1130394078 15:83486916-83486938 CTTATAAAGAAGAGGAAGAGAGG - Intronic
1133567970 16:7013028-7013050 CCTTAAAAGGAGAGAAAGAGAGG - Intronic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1137372126 16:47917230-47917252 ATTTATTAGCAGAGAAAGAATGG + Intergenic
1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG + Intergenic
1137441192 16:48499687-48499709 CTTTATAAGCTGAGTATTAGAGG + Intergenic
1137539205 16:49350381-49350403 CCTTATGAGAAGAGGAAAAGGGG + Intergenic
1137892581 16:52178145-52178167 CTTTATAAGGACAAGAAGGGAGG + Intergenic
1138058944 16:53868274-53868296 CTATAAAAGCAGAAAAAGAGTGG - Intronic
1139350478 16:66331923-66331945 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1139352060 16:66343050-66343072 CTTTGAAGGCAGAGGAGGAGAGG - Intergenic
1139870149 16:70101349-70101371 CTGTATAAGCAGAGACAGATTGG + Intergenic
1140385296 16:74531204-74531226 CTGTATAAGCAGAGACAGATTGG - Intronic
1140550071 16:75856095-75856117 CTTTATAGACACAGGATGAGGGG - Intergenic
1140710225 16:77670682-77670704 CCTTATACGAGGAGGAAGAGAGG + Intergenic
1140837822 16:78811670-78811692 CCTTATAAGAAGAGGACAAGGGG - Intronic
1140895545 16:79321410-79321432 CATTTTATCCAGAGGAAGAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141402796 16:83765096-83765118 TGTTACAAGCACAGGAAGAGAGG - Intronic
1141778243 16:86138728-86138750 CCTTATAAGAAGAGGACAAGAGG - Intergenic
1141999658 16:87656949-87656971 CCTTATAAGAAGAGGAGGAGAGG - Intronic
1142339111 16:89508874-89508896 CTTTAAAAGGCGAGGAAGACGGG - Intronic
1142496047 17:306856-306878 CATGAGAAGGAGAGGAAGAGAGG - Intronic
1144444108 17:15310474-15310496 CTTTATAAGCAGAGGAAATTTGG + Intronic
1146668209 17:34718750-34718772 TATTAAGAGCAGAGGAAGAGAGG - Intergenic
1147445343 17:40471865-40471887 CTTTATAAGAAAGGGAAGAGAGG + Intergenic
1148456500 17:47814130-47814152 CTTTATAAACACAGAAACAGAGG + Intronic
1149057104 17:52379638-52379660 CTTTATAGGCACAGGATGGGAGG - Intergenic
1150603070 17:66667302-66667324 CTTTATTAGCAGTGTAAGAACGG - Intronic
1151355287 17:73554439-73554461 CCTTATAAGCAGAGGAGGTGAGG + Intronic
1152174128 17:78775470-78775492 CTTTCTCTGTAGAGGAAGAGTGG - Intronic
1155484190 18:26323979-26324001 CATAAGAAGCAGAGGAAGTGAGG - Intronic
1155781090 18:29837135-29837157 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1155990361 18:32273427-32273449 GATTATAAGTACAGGAAGAGGGG - Intronic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1156307818 18:35895231-35895253 CTTTATAAGATGAGAAAGGGAGG + Intergenic
1156657272 18:39303584-39303606 CTTTCTAAAAAGAGAAAGAGAGG + Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156885163 18:42126880-42126902 CTTCATAAACAGTGGGAGAGTGG + Intergenic
1156889494 18:42174395-42174417 CTATGTAAGCAGAGGTATAGAGG - Intergenic
1156916364 18:42467637-42467659 CTGTATAGGCACAGGAAGAAAGG - Intergenic
1157630049 18:49086332-49086354 CTTTATAAGAGGAGAAAGAGAGG - Intronic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158348057 18:56535727-56535749 CTCTCTAATCAGAGGCAGAGTGG - Intergenic
1158403280 18:57140039-57140061 CTTTATAAACAGAGGAAATCTGG + Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1158897013 18:61923629-61923651 ATTTACAAGAAGAGGAACAGAGG - Intergenic
1159144076 18:64430777-64430799 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1159374853 18:67580115-67580137 CTTTATAAGAAAAGTAAGAGAGG + Intergenic
1159692371 18:71504844-71504866 CTTTATTAGCAGTGAGAGAGTGG + Intergenic
1159777529 18:72620559-72620581 CTTCATAGGCACAGGATGAGGGG + Intronic
1160233256 18:77065327-77065349 CTTTGTAAGGAGAGGAAGAGAGG - Intronic
1163263557 19:16205391-16205413 CTTTATAAGCAGGGGCAGTGGGG - Intronic
1163283039 19:16328676-16328698 CTTCATCAGCAGCGGAAGTGAGG - Intergenic
1165681575 19:37780834-37780856 CTTTTTAAGAAGAGGAAAATCGG - Intronic
1166238593 19:41474159-41474181 CTTAATATTCAGAGGAGGAGAGG - Intergenic
1166657009 19:44619744-44619766 CCTTATAAGAAGAGGAAGTTTGG - Intronic
1166972168 19:46576314-46576336 CCTTATAGGAAGAGGAAGAGAGG - Intronic
1167264736 19:48477977-48477999 CGTGAGAAGCAGAGCAAGAGCGG - Intronic
925062067 2:899794-899816 CCTTATAAGAAGAGGAAATGAGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
925934170 2:8737314-8737336 CTTAATAAGAGGAAGAAGAGAGG + Intronic
926562741 2:14435308-14435330 CTTTATAGGCACAGGATGGGGGG + Intergenic
926781808 2:16479880-16479902 CTTTATAAGTAAAAGAGGAGTGG - Intergenic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
927063488 2:19446253-19446275 CTTTATCAGCAGTGTAAGAATGG + Intergenic
927074223 2:19560750-19560772 CTTTCTTAGCAGAGAAAGAGAGG - Intergenic
927922709 2:26985794-26985816 CTTTATAAGCAGGAGGACAGAGG + Intronic
928825958 2:35421245-35421267 CTTTATAAGCAGAGGAAATATGG - Intergenic
929262750 2:39883884-39883906 TTTTAGATGCAGAGGAAGAAGGG + Intergenic
929384155 2:41384414-41384436 CTGTGTAAGCACAGGAAGAAAGG - Intergenic
930222311 2:48756988-48757010 ATCTATAAGCAGTTGAAGAGAGG - Intronic
931916317 2:66960706-66960728 CTTTATAAGCACAGGAGAGGGGG + Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
932360746 2:71103719-71103741 CTTTATAGGCACAGGAAGGGGGG - Intergenic
932611298 2:73202402-73202424 TTTTAAAAGCGGAGGAAGGGAGG + Exonic
933298257 2:80514785-80514807 CTTTATAGGCACAGGATGGGGGG + Intronic
933456570 2:82526416-82526438 CCTAATAACCAGGGGAAGAGAGG - Intergenic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
933825159 2:86153151-86153173 CTATATAAGCTGAGGAGGAGTGG + Intronic
934141888 2:89054823-89054845 CTTTGTAAGCGCAGGAAGAAAGG - Intergenic
934227349 2:90145723-90145745 CTTTGTAAGCGCAGGAAGAAAGG + Intergenic
934569849 2:95362404-95362426 CCTTATATGAAGAGTAAGAGAGG - Intronic
935409149 2:102740557-102740579 CTTTATAAGCAGTGCGAGAATGG + Intronic
935671929 2:105563319-105563341 ATTTCAAAGCAGAGGAGGAGTGG + Intergenic
936580011 2:113691210-113691232 CTTTATTAGCAGCGTAAGAATGG + Intergenic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
936826043 2:116582263-116582285 TTTTATAAGAAGAGAGAGAGGGG + Intergenic
936858379 2:116987228-116987250 CTTTATAGGCACAGGATGGGGGG - Intergenic
937425682 2:121796682-121796704 CTTCATAAGAAGAGGAAGCAAGG - Intergenic
937508943 2:122570933-122570955 TTTTATAGGCACAGGATGAGGGG + Intergenic
937761247 2:125605442-125605464 CTTTATTAGCAGTGTAAGAATGG + Intergenic
938039011 2:128060239-128060261 CTTTATAGGAAGAGGAAGTTTGG + Intergenic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938849242 2:135243597-135243619 TTTTTTAAGTACAGGAAGAGAGG - Intronic
939565765 2:143784883-143784905 TTTTATCAGGAGAGGAAGAAAGG + Intergenic
939927899 2:148196813-148196835 TTTTATAAGCAAAGGGAGTGGGG + Intronic
940236440 2:151515859-151515881 CTTTATAGTTGGAGGAAGAGAGG + Intronic
940450095 2:153826242-153826264 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
940863084 2:158790161-158790183 CTTTATAAGAAGTGGAGGAGAGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941855231 2:170224109-170224131 CTTGCTAAGCAGAGGCATAGTGG + Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942676893 2:178435791-178435813 ATTTATAAGTAAAGGAAGAAAGG - Intronic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944251729 2:197585662-197585684 CTGTGTAAGCACAGGAAGAAAGG - Intronic
944562782 2:200957691-200957713 CTATATAAACTGTGGAAGAGTGG - Intronic
944677750 2:202048357-202048379 CCTTATGGGAAGAGGAAGAGAGG + Intergenic
945437271 2:209833312-209833334 CTTCATGAGCAGAGAGAGAGGGG + Intronic
946013486 2:216585190-216585212 CTTTATAAGAAGAAGAAATGAGG + Intergenic
946887458 2:224237096-224237118 CCTTATGAGAAGAGGAAGAGAGG - Intergenic
947102051 2:226631204-226631226 CTTCCTAGGGAGAGGAAGAGAGG + Intergenic
947263726 2:228252865-228252887 CTTTATAAGCCAAGAAAGATTGG - Intergenic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947960994 2:234237208-234237230 CTTTATAAGAAGGGGAAGAGAGG + Intergenic
948415629 2:237801032-237801054 CTTTTTAAGAATATGAAGAGCGG + Intronic
1169021803 20:2336027-2336049 CCCTATGAGCAGAGAAAGAGGGG - Intronic
1169324989 20:4668407-4668429 CCTTGTAAGAAGAGGAAGACAGG - Intergenic
1169912257 20:10656583-10656605 CCTTGTAAGGAGAGGAAGATGGG + Intronic
1170073376 20:12392724-12392746 CATTATAAGAAGAGGAAATGTGG + Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170710714 20:18787933-18787955 CTTTATCAGCAGAGTAAATGTGG - Intergenic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1172784221 20:37455726-37455748 CCTTAAAAGAAGAGGAAGAGAGG + Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173057618 20:39631257-39631279 ATTTACAAACAGAGTAAGAGTGG - Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1174310183 20:49646926-49646948 TTTTAAAAGCAGAGGAAGACAGG + Intronic
1175299937 20:57935585-57935607 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1177022870 21:15884976-15884998 CCTTATAAGAACTGGAAGAGAGG - Intergenic
1177801556 21:25833554-25833576 CTTTATAGGCACAGGATGGGGGG - Intergenic
1177962112 21:27680108-27680130 CTTTATAGGCACAGGATGTGGGG + Intergenic
1178218510 21:30628148-30628170 CTTTATAAGCTGAGAAAAAGGGG - Intergenic
1178224316 21:30698266-30698288 CTTTATTTGCAGAGGAGGAGGGG - Intergenic
1178316286 21:31569355-31569377 CCTTATAAGAAGAGGAAGTTTGG - Intergenic
1178348586 21:31852967-31852989 CTTTATTAGCAGCGTAAGAATGG + Intergenic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1178419272 21:32430488-32430510 CTTTATTAGCAGAGTGAGAATGG - Intronic
1178712115 21:34926766-34926788 TTTTCTAAGCACAGGAAGAATGG + Intronic
1178846433 21:36177677-36177699 CTAAATAAGAAGAGGAAGAGAGG + Intronic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1180608519 22:17080145-17080167 CTTTATATGAAGAGGAAGATAGG - Intergenic
1181291536 22:21798190-21798212 CTATATCAGCTGAGGTAGAGAGG + Intronic
1182679266 22:32065926-32065948 CTTGCTAAGCAGATGAAGAGTGG - Intronic
1184349410 22:43933912-43933934 CTTTATAAGCAGATGAGTAGAGG + Intronic
1185051265 22:48555531-48555553 CTTTATGGGAAGAGGGAGAGAGG + Intronic
1185086062 22:48741631-48741653 CTTTCTAAGAAGAGGAGGTGAGG + Intronic
1185294788 22:50047711-50047733 CTCTATCAGCAGGGGAGGAGCGG - Intronic
949095165 3:77187-77209 CTCTCTCAGCAGAGCAAGAGGGG + Intergenic
949546140 3:5074423-5074445 CTTGATAAACAGAGTACGAGAGG + Intergenic
950656064 3:14437097-14437119 CTTTATCAGCACAGGAAGGATGG + Intronic
950766236 3:15275102-15275124 CCTTGTAAGAAGGGGAAGAGAGG + Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
951522806 3:23625347-23625369 CTTTATAAGAAGAGGAGAAGAGG - Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
952325654 3:32318374-32318396 CTTTATGAGAGGAGGAAGGGTGG - Intronic
952631351 3:35472146-35472168 CTTTATTAGCAGCGTAAGAATGG - Intergenic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953386256 3:42507673-42507695 CTTTATTTGCAGAGGAACACAGG - Intronic
955054195 3:55441600-55441622 CTTTGAAAGCAGAGGAAGTTGGG + Intergenic
955572095 3:60319021-60319043 CTTTGTAAGAAGAGGAAGGCAGG - Intronic
956100731 3:65765394-65765416 CTTAATAAGCAGTGGAACATTGG - Intronic
956174539 3:66460522-66460544 CTTTATAAGAAGAGGAAATCTGG + Intronic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
958060802 3:88477356-88477378 CTTTATAAGCAGCTAAAGAGAGG - Intergenic
958414302 3:93855561-93855583 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
958567243 3:95830074-95830096 CCTTATAAGAAGAGGAAATGTGG + Intergenic
958794171 3:98689676-98689698 CTTTATAAACAGGAGAAGTGTGG + Intergenic
959081175 3:101802629-101802651 CTTAATAAGCATAGGAAGTCAGG + Intronic
959465634 3:106682786-106682808 TTTTATACACAGAGAAAGAGAGG + Intergenic
959556718 3:107728208-107728230 CTTTATAAGTAGAGGAATTGAGG + Intronic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961884691 3:130088897-130088919 CTTTATTAGCAGAGTGAGAATGG + Intronic
963066764 3:141270369-141270391 CTTTAAAAGCAGACGATGAGAGG + Intronic
963118294 3:141752827-141752849 CTTTATAGGAAGAGGATGAGAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
963982624 3:151556933-151556955 TTTTAGAAGGAGAGGAAGAGTGG + Intergenic
964402928 3:156318056-156318078 CTTTAAAAGCAGTGACAGAGAGG + Intronic
965836630 3:172860453-172860475 CCTTTTAAGAACAGGAAGAGAGG + Intergenic
965863332 3:173173508-173173530 ATTTAAAAAGAGAGGAAGAGAGG + Intergenic
966327429 3:178772622-178772644 CTTTATCAGCAGTGTAAAAGTGG + Intronic
967749745 3:193100534-193100556 CTTTATTAGCAGTGTGAGAGTGG + Intergenic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
967941452 3:194769413-194769435 ATTTCTAAGCAGGGGAAGCGCGG + Intergenic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
969820097 4:9713391-9713413 CTTTATTAGCAGAGTGAGAAAGG - Intergenic
970030948 4:11673937-11673959 CTCTAAAAGCAGGGGAACAGAGG - Intergenic
970440663 4:16078559-16078581 CTTAATACAGAGAGGAAGAGTGG - Intronic
970674560 4:18433770-18433792 CTTTATCAGCAGTGTAAGAAGGG + Intergenic
970705405 4:18795573-18795595 TTTTATAAGGAGAAGAAGAGAGG - Intergenic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
971017404 4:22502590-22502612 CTTTTTTAACAGAGGAAGAAAGG + Intronic
971111776 4:23592939-23592961 CTTTATTAGCAGTGGGAGAATGG + Intergenic
971278561 4:25221669-25221691 CTTTATTAGCAGTGGGAGAATGG - Intronic
971561637 4:28085250-28085272 CTTTAAAAGCAGTGTAAGAATGG - Intergenic
971760607 4:30760104-30760126 CTTGAGAAGCAGAGGAACAATGG - Intronic
972184330 4:36510536-36510558 CCTTATAAGAAGAGGAAATGTGG + Intergenic
972329379 4:38050272-38050294 CCTTACAGGCAGAGCAAGAGAGG + Intronic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
972745705 4:41930529-41930551 CATTATAAGAAGAGAAAGAGAGG + Intergenic
972745829 4:41931943-41931965 CCTTATAAGAAGGGGAAGAGAGG + Intergenic
973242920 4:47977247-47977269 CCTTATAAGAAGAGGAAACGTGG + Intronic
973656504 4:53053665-53053687 CTCTCTAGGCAGAGGAAAAGCGG - Intronic
974032007 4:56784552-56784574 CCTTATAAAAAGAGGAGGAGAGG + Intergenic
974269115 4:59627217-59627239 TTTTATAAGCAAAGGAACTGAGG + Intergenic
974432978 4:61822201-61822223 CTTTACAAGCATAGGAACACAGG - Intronic
974620984 4:64354349-64354371 CTTTAAAAGTAGAGAAACAGAGG + Intronic
974737535 4:65956986-65957008 TTTTATAAGAAGATGAAAAGTGG - Intergenic
974778134 4:66514939-66514961 CTTTCTAAGTACAGGAAAAGTGG - Intergenic
976540668 4:86271576-86271598 CTTTATTAGCAGCGTGAGAGTGG - Intronic
977778715 4:100954959-100954981 CTTTAAAAGCTGTGTAAGAGAGG - Intergenic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
979089400 4:116462191-116462213 CATTATGAGAAGAGGAAGGGAGG - Intergenic
979482562 4:121236686-121236708 CTTTATGAGCAAAGGACCAGAGG - Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980272932 4:130610552-130610574 ATCTATAATCAGAGGAAGAAAGG + Intergenic
981842974 4:149133845-149133867 CCTTATAAGAAGAGGAAATGTGG + Intergenic
982078917 4:151767796-151767818 GTTTAAAAGTACAGGAAGAGAGG - Intergenic
982408485 4:155046130-155046152 CATTTTAGGCAGTGGAAGAGGGG + Intergenic
982606545 4:157523490-157523512 CTTTATAGGCACAGGATGGGGGG + Intergenic
982873886 4:160620056-160620078 CCTTGTAAGAAGAGGAGGAGAGG - Intergenic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
983172561 4:164552297-164552319 CTTTATAGGCACAGGATGCGGGG + Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984606798 4:181795362-181795384 CTTTATAAGAAGAGACACAGGGG - Intergenic
984907085 4:184638358-184638380 CTTTATAATCAGAGAAAGATGGG - Intronic
985150580 4:186943269-186943291 GACTATAAGCAGAGGAAGAGTGG + Intergenic
985394192 4:189524795-189524817 CTTTATAAGCAGTGTGAAAGTGG + Intergenic
985417381 4:189750614-189750636 CTTTATTAGCAGTGTAAGAATGG - Intergenic
985816837 5:2133698-2133720 CCTTATAAGAAGAGGAGAAGAGG - Intergenic
986396455 5:7335588-7335610 CTTTATAAGGAGAGGAAGAGAGG - Intergenic
986466527 5:8031580-8031602 CTTCAGAAGCAGAGGAGAAGAGG - Intergenic
986937814 5:12913019-12913041 CTATATAACCAGAGGGACAGAGG - Intergenic
987022527 5:13889537-13889559 CTTTATCAGCAGGGCAACAGGGG - Intronic
987151522 5:15045466-15045488 CTTTATTACCTGAGGATGAGAGG + Intergenic
987165660 5:15195369-15195391 CTTTATTAGCAGAGTGAGAATGG - Intergenic
987171861 5:15267491-15267513 CTTTATAAGCTCAGAAGGAGAGG - Intergenic
987820607 5:22961515-22961537 CCTTATAAGAAGAGGAGGAGAGG - Intergenic
988111609 5:26829991-26830013 CTTTATAAGAGGAGAAAAAGTGG - Intergenic
988130765 5:27101871-27101893 CATTATAACTAGAGGTAGAGTGG + Intronic
988259330 5:28863386-28863408 CTCTAAAAGCAAAGGAAGATAGG - Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
989173764 5:38499935-38499957 AGTTGTAGGCAGAGGAAGAGAGG - Intronic
989756669 5:44963411-44963433 TTTTATAAGCTAAGGGAGAGGGG - Intergenic
990059779 5:51633168-51633190 CTTTAAAAACAGAGAAAGACTGG - Intergenic
990079598 5:51897138-51897160 CTTTATAAGAAGAGGAGGTTTGG - Intergenic
990594796 5:57302016-57302038 CTTTATTAGCAGAGTGAGAATGG - Intergenic
990681070 5:58245000-58245022 CATTACAATCAGAGGAAGAAGGG + Intergenic
991130737 5:63119918-63119940 CTTTGAAAGCCAAGGAAGAGAGG + Intergenic
992027605 5:72685984-72686006 TCTTATAAGAAGAGAAAGAGAGG + Intergenic
992778612 5:80108853-80108875 CTCTATAAGAAGAGGAAAATTGG + Intergenic
993339366 5:86704252-86704274 CTTTAAAAGAAGATGAGGAGTGG - Intergenic
994111279 5:96007602-96007624 CCTTTTAAGAAGAGGAAGATGGG + Intergenic
994119983 5:96102442-96102464 CTTTATAGGCACAGGATGGGGGG + Intergenic
994394011 5:99213690-99213712 CCTAATATGCAGGGGAAGAGAGG - Intergenic
994394085 5:99214283-99214305 CTTAATATCCAGAGGAGGAGAGG - Intergenic
994937825 5:106278734-106278756 ATTTAAAAAGAGAGGAAGAGAGG - Intergenic
994975549 5:106800008-106800030 CTGAATAAGATGAGGAAGAGAGG - Intergenic
995610734 5:113908099-113908121 CTTTATAAGAACAGGAAGTTTGG + Intergenic
996874520 5:128226359-128226381 CTTTACAAAAAGAGGAATAGAGG + Intergenic
997632563 5:135379857-135379879 CTTGAAAAGCAGAGGAAGTCAGG - Intronic
997687733 5:135800469-135800491 CCTAATATGCAGGGGAAGAGAGG + Intergenic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
997966885 5:138364735-138364757 ATTTATAGGCAAAGGAAGTGAGG + Intronic
998252592 5:140562793-140562815 CTTGATAAGCACAGGATGAGGGG + Intronic
999450644 5:151675271-151675293 CTTAGTAAACAGAGGATGAGGGG + Intronic
999451382 5:151680917-151680939 CTTTATAAGCCCAGGGAGAAAGG + Intronic
999537672 5:152535308-152535330 CTTTATAAGAGGAGGAAGAGAGG + Intergenic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1000249992 5:159485133-159485155 CTCTAGAAGCAAAGGAAAAGAGG + Intergenic
1000285592 5:159823692-159823714 CTTTATAAGAAGTGAGAGAGAGG - Intergenic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1002886914 6:1305531-1305553 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1003062162 6:2872409-2872431 CTTTATTAGCAGCGTAAGAATGG - Intergenic
1003668363 6:8132417-8132439 CTTTGTAAGAAGAGGAAATGTGG - Intergenic
1004364894 6:15003630-15003652 TTGTATAAGGAAAGGAAGAGTGG + Intergenic
1004545557 6:16595158-16595180 TATTAGAAGCAGAGGAAGAGAGG + Intronic
1005516313 6:26557883-26557905 CTATATAATCAGAGCAAAAGGGG + Intergenic
1005937213 6:30532482-30532504 CCTTATAAAGAGATGAAGAGAGG - Intergenic
1006348901 6:33506249-33506271 CTTCATAAGCACACGATGAGGGG - Intergenic
1006782469 6:36641331-36641353 CTTTATAAGAAAAGGAAGTGTGG + Intergenic
1007294207 6:40809371-40809393 TCTTATAAAAAGAGGAAGAGAGG - Intergenic
1007859444 6:44892283-44892305 CTTTATAAGATGAGGAAGAGAGG + Intronic
1008881234 6:56382611-56382633 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009445974 6:63742580-63742602 CATTATTGGCATAGGAAGAGGGG - Intronic
1009518023 6:64643914-64643936 CTTTATCAGCAGCGTGAGAGTGG + Intronic
1009765855 6:68074583-68074605 CTTTATAGGCATAGGATGGGTGG + Intergenic
1011436575 6:87344446-87344468 TTTTATAAGAAGAGGAAGAGAGG + Intronic
1011876630 6:91970720-91970742 CTTTATCAGCAGAGTAAAAGTGG - Intergenic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1012775306 6:103488694-103488716 CTTAATAATCAGAGGGGGAGAGG + Intergenic
1013147104 6:107404448-107404470 CTTTATTAGCAGTGGGAGAACGG - Intronic
1013186453 6:107763698-107763720 TCTTAAAAGAAGAGGAAGAGAGG + Intronic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014125329 6:117770324-117770346 CTTTATATGGAGAGAGAGAGAGG - Intergenic
1014503538 6:122224610-122224632 CTTTAAAAGAAGAGAAAGAAAGG - Intergenic
1014545151 6:122726690-122726712 TTTTATAATCAGATAAAGAGGGG + Intergenic
1014962731 6:127706905-127706927 CTTTATTAGCAGTGTAAGAATGG - Intergenic
1015522297 6:134143819-134143841 CTTTATGAAAAGAGGAAGAGGGG + Intergenic
1015932465 6:138375265-138375287 CTTTATAGGCACAGGATCAGGGG + Intergenic
1016020960 6:139235790-139235812 TTTTATAGGCACAGGAAGGGGGG - Intergenic
1016250907 6:142041183-142041205 CTGTGTATGCAGTGGAAGAGTGG - Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1017063846 6:150510305-150510327 CTTTACAAGCAGAGGGAGCTGGG + Intergenic
1017448135 6:154528178-154528200 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1019791260 7:3015446-3015468 CCTTATAAGAAGAGGAAATGAGG - Intronic
1020318069 7:6920906-6920928 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1021260966 7:18456698-18456720 TTTTATAGACACAGGAAGAGAGG - Intronic
1022165028 7:27750466-27750488 CTGTATAAGCAGAGGCTTAGAGG + Intronic
1022549166 7:31220770-31220792 CTTTATAAGAAGAGAAAATGTGG - Intergenic
1022573939 7:31479771-31479793 CTTTGTAGGAAGAGGAAGAGAGG + Intergenic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1024119857 7:46225777-46225799 CTTTATAAGCATAGGTAATGAGG + Intergenic
1024377796 7:48658828-48658850 CTTCATGAGCAAATGAAGAGTGG - Intergenic
1024424859 7:49213511-49213533 CTTTATCAGCAGAGTGAAAGTGG - Intergenic
1024830684 7:53451776-53451798 CTTTATGAGAAGAGGAAATGTGG - Intergenic
1025195110 7:56926570-56926592 CTTTAGAAGTAGGAGAAGAGGGG + Intergenic
1025676842 7:63650373-63650395 CTTTAGAAGTAGGAGAAGAGGGG - Intergenic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026180584 7:68035949-68035971 CTTTATAAGAAGAGGAGGATGGG + Intergenic
1026423910 7:70270470-70270492 TTTCAGAAGCAGAGGATGAGTGG + Intronic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1029343738 7:99964098-99964120 CTTAATATCCAGAGGAGGAGAGG - Intergenic
1029570771 7:101367362-101367384 TGTTATAAGAACAGGAAGAGAGG + Intronic
1029795605 7:102891153-102891175 CTCTATAGGGACAGGAAGAGAGG + Intronic
1030674211 7:112367708-112367730 CCTTCCAAGAAGAGGAAGAGAGG - Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1031455249 7:121971288-121971310 CTTTATAACCAGAGAAAAATGGG + Intronic
1032746587 7:134792585-134792607 CTTTATAAGAAGAGGAGGCTAGG - Intronic
1032776263 7:135116729-135116751 CCATGTAAGCAGAGGCAGAGGGG - Intronic
1033095917 7:138430594-138430616 CTTTATTAGCAGTGGGAGAACGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034074944 7:148222419-148222441 GTCTATAAGAAGAGGAAGAGAGG - Intronic
1034082096 7:148288397-148288419 CTTTAAAGAAAGAGGAAGAGAGG - Intronic
1034119959 7:148618182-148618204 CTTTATAAGCAGTGTGAGAATGG - Intergenic
1034252546 7:149703869-149703891 CCTTATAGGAAGAGGAGGAGCGG - Intergenic
1036131971 8:6123914-6123936 CTTTTTAATCAGATGATGAGTGG - Intergenic
1037331468 8:17747745-17747767 CTTTATAAGCAGCGTAAAAATGG - Intronic
1038276729 8:26127527-26127549 CTTTATAAGAAGAGGAAGTTTGG - Intergenic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038430947 8:27499094-27499116 CTTTATAAGAAGTGGAAGTGAGG - Intronic
1038471361 8:27825511-27825533 CTTTAGAAGCTGGGGAAGGGGGG - Intronic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038670211 8:29577084-29577106 CATTAAAAGGAGAGGAAAAGTGG - Intergenic
1039037911 8:33379242-33379264 CTTTATAAGCAGTGGGAAAATGG + Intronic
1039306847 8:36272545-36272567 TTTTATAGGCACAGAAAGAGGGG - Intergenic
1041735858 8:61109791-61109813 TTTTATAAGAAGAGGAGGAGAGG + Intronic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042052890 8:64731131-64731153 CTTTATTAGCAGCGGGAGAATGG + Intronic
1042614678 8:70635128-70635150 GGTTATAAGAGGAGGAAGAGAGG + Intronic
1042693536 8:71530162-71530184 CTTTATAAGAAGAGAAGGAGGGG + Intronic
1043367080 8:79545003-79545025 CTTTATAAGCCAGGAAAGAGTGG + Intergenic
1043746738 8:83882184-83882206 TTTAATAAGCAGAGAAAAAGGGG + Intergenic
1043794656 8:84521178-84521200 CCTTATAAGAAGTGGAAGAGAGG + Intronic
1043833893 8:85022758-85022780 CTGTAAAAGAAGAGTAAGAGTGG - Intergenic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045251067 8:100483956-100483978 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1045924850 8:107571729-107571751 CCTTATAACCAGGGGGAGAGAGG + Intergenic
1046140823 8:110089262-110089284 CTTTATTAGCAGTGTGAGAGTGG - Intergenic
1047347326 8:124040764-124040786 CTTCAGAAGAAGAGGAAGAGAGG - Intronic
1047393116 8:124470500-124470522 CTTCATAAAAAGAGGAAGAAAGG + Intergenic
1047515867 8:125554483-125554505 CTTTCTAAGCAGAGAGAAAGAGG + Intergenic
1048187827 8:132260531-132260553 CTAGATAAGAAGAGGAAGAGAGG + Intronic
1048193530 8:132311952-132311974 CGTTATAAACAGAAGAGGAGAGG + Intronic
1048407281 8:134136645-134136667 CTTTATAAAAAGAAGATGAGGGG + Intergenic
1048792196 8:138114354-138114376 CTTTATTAGCAGTGTAAGAACGG + Intergenic
1049022468 8:139967035-139967057 CTTTAAATGCAGTGGAAGTGCGG + Intronic
1049348624 8:142152373-142152395 CACTAAAGGCAGAGGAAGAGAGG - Intergenic
1050024133 9:1316119-1316141 CTTTATTAGCAGTGTAAGAATGG - Intergenic
1051164008 9:14241802-14241824 GTCTATAAGGAGAGGAAGAATGG - Intronic
1051741563 9:20257568-20257590 GTTTATAAGTACAGAAAGAGAGG + Intergenic
1051847712 9:21471023-21471045 ATTCATTAGCAGAGAAAGAGAGG - Intergenic
1051868773 9:21713059-21713081 CTTTAGAAGTAGGGGCAGAGGGG - Intergenic
1052088426 9:24296185-24296207 ATATATAAGCAGCTGAAGAGAGG + Intergenic
1052430950 9:28365848-28365870 CCTTAGAGGCAGAGGCAGAGTGG + Intronic
1052672962 9:31581532-31581554 TTCTAGAAGCAGAGGAATAGTGG - Intergenic
1054689981 9:68315039-68315061 CCTTATATCCAGGGGAAGAGAGG - Intergenic
1054814662 9:69463700-69463722 CAATGTAGGCAGAGGAAGAGAGG + Intronic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1055708499 9:79033870-79033892 CTTTATAGGCAAAGGATGGGGGG + Intergenic
1055986988 9:82062510-82062532 TTTTATAAAAACAGGAAGAGGGG + Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056308510 9:85315944-85315966 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1056667216 9:88590332-88590354 CCTTATAAGCACAGGATGGGGGG - Intergenic
1056849627 9:90071457-90071479 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
1058056650 9:100455573-100455595 CTAGATGTGCAGAGGAAGAGAGG + Intronic
1058265503 9:102894137-102894159 CTTTATATTAAGGGGAAGAGGGG + Intergenic
1058278181 9:103074321-103074343 CTTTATGAGCAGTGTAAGAATGG + Intergenic
1059680024 9:116576865-116576887 CTTTATAAGCAAGGTAAGGGTGG - Intronic
1059932781 9:119277909-119277931 TTTTCTAAGCAGAGGTAGGGGGG - Intronic
1060574964 9:124683333-124683355 CTTAGTAAGCAGAGGAATTGTGG - Intronic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1062618613 9:137409178-137409200 CTTTATAAGAGGAGGAGGAGAGG + Intronic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1185860845 X:3577954-3577976 GTTTATAATGAGAGGAACAGGGG + Intergenic
1185943338 X:4346090-4346112 CCTTATAAGAAGAGGAGAAGAGG + Intergenic
1185964531 X:4585845-4585867 CTTTATAAGAAGAGGAGGCTGGG + Intergenic
1186458274 X:9727921-9727943 CTTTACAGGCAGAAAAAGAGAGG - Intronic
1186539609 X:10387166-10387188 TTTTATCAGGAGAGCAAGAGTGG - Intergenic
1186586104 X:10874777-10874799 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1187540661 X:20190827-20190849 CTGTATTAACACAGGAAGAGAGG - Intronic
1188577552 X:31670762-31670784 TTTTATAAGAAGAGGAAAAGAGG - Intronic
1189080186 X:37962806-37962828 CTTTATTAAAAGAGGAAGAGGGG - Intronic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189392135 X:40585251-40585273 CTTTACATGGAGAGGATGAGAGG + Intronic
1189547552 X:42057331-42057353 CCTTATTAGAAGAGGAAGTGAGG - Intergenic
1190055317 X:47178155-47178177 CTGGTTAAGCAGAGGAGGAGAGG - Intronic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1190575173 X:51829089-51829111 GGTATTAAGCAGAGGAAGAGAGG + Intronic
1190636203 X:52436467-52436489 CCTTATAAGAAGAGGAAATGAGG - Intergenic
1191599020 X:62983008-62983030 CTTTATTAGCAGTGTAAGAAGGG - Intergenic
1192002415 X:67168110-67168132 TTGTATAAGCAGAGAAAGAAAGG - Intergenic
1192403007 X:70855746-70855768 CTTTATAACCAGAGGAAATTTGG + Intronic
1192415158 X:70973171-70973193 CTTTATAAGAAGAGGAGGCCAGG + Intergenic
1194049495 X:89052149-89052171 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1194344252 X:92743680-92743702 CTTTATAAGTAGAGGAAATTAGG - Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1196283412 X:113851113-113851135 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1197022056 X:121703176-121703198 CTTTAACAACAGAGAAAGAGAGG - Intergenic
1198147164 X:133868784-133868806 TGTTATCAGCAGAGGAAGGGAGG - Intronic
1198406277 X:136315785-136315807 CTTTATAAGAAGAAAAAGTGTGG + Intronic
1198512821 X:137371390-137371412 CCTTATAAGAAGAGGAAATGTGG - Intergenic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1198608898 X:138375232-138375254 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1199020475 X:142871680-142871702 CTTTATCAGCAGTGTAAGAATGG + Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1199338078 X:146642865-146642887 CTTTATTAGCAGTGTAAGAATGG + Intergenic
1199735978 X:150687097-150687119 CTTTACAAGAAGAGGAAGAGAGG - Intergenic
1200291921 X:154883678-154883700 CTTTATAAGAATAGGAAGAGAGG - Intronic
1200298712 X:154950064-154950086 CCTTATAAGAAGAGGAAATGTGG - Intronic
1200338759 X:155379415-155379437 CTTTATAAGAATAGGAAGAGAGG - Intergenic
1200347710 X:155461277-155461299 CTTTATAAGAATAGGAAGAGAGG + Intergenic