ID: 1170716171

View in Genome Browser
Species Human (GRCh38)
Location 20:18832935-18832957
Sequence GAGAGAAAGGAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170716163_1170716171 22 Left 1170716163 20:18832890-18832912 CCAGGGAATGCTTTTCTTGATGT No data
Right 1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170716171 Original CRISPR GAGAGAAAGGAGAGGGAGGC TGG Intergenic
No off target data available for this crispr