ID: 1170721101

View in Genome Browser
Species Human (GRCh38)
Location 20:18879723-18879745
Sequence TCCTCTGGTTGCCCTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170721094_1170721101 4 Left 1170721094 20:18879696-18879718 CCTTCTCCCTGTGATGTTTTTCC No data
Right 1170721101 20:18879723-18879745 TCCTCTGGTTGCCCTCCTGATGG No data
1170721096_1170721101 -3 Left 1170721096 20:18879703-18879725 CCTGTGATGTTTTTCCCCACTCC No data
Right 1170721101 20:18879723-18879745 TCCTCTGGTTGCCCTCCTGATGG No data
1170721095_1170721101 -2 Left 1170721095 20:18879702-18879724 CCCTGTGATGTTTTTCCCCACTC No data
Right 1170721101 20:18879723-18879745 TCCTCTGGTTGCCCTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170721101 Original CRISPR TCCTCTGGTTGCCCTCCTGA TGG Intergenic