ID: 1170722738

View in Genome Browser
Species Human (GRCh38)
Location 20:18898166-18898188
Sequence GCATTTAAACACATGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170722738_1170722748 9 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722748 20:18898198-18898220 CTGTGATGGTATTAGGAGGTGGG No data
1170722738_1170722741 -5 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722741 20:18898184-18898206 AATGCTAACCCCTACTGTGATGG No data
1170722738_1170722750 17 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722738_1170722747 8 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data
1170722738_1170722749 10 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219
1170722738_1170722751 29 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722738_1170722742 2 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722742 20:18898191-18898213 ACCCCTACTGTGATGGTATTAGG No data
1170722738_1170722746 5 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722746 20:18898194-18898216 CCTACTGTGATGGTATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170722738 Original CRISPR GCATTTAAACACATGGATTT GGG (reversed) Intergenic
No off target data available for this crispr