ID: 1170722747

View in Genome Browser
Species Human (GRCh38)
Location 20:18898197-18898219
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170722738_1170722747 8 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data
1170722737_1170722747 9 Left 1170722737 20:18898165-18898187 CCCCAAATCCATGTGTTTAAATG No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data
1170722739_1170722747 7 Left 1170722739 20:18898167-18898189 CCAAATCCATGTGTTTAAATGCT No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data
1170722736_1170722747 10 Left 1170722736 20:18898164-18898186 CCCCCAAATCCATGTGTTTAAAT No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data
1170722740_1170722747 1 Left 1170722740 20:18898173-18898195 CCATGTGTTTAAATGCTAACCCC No data
Right 1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170722747 Original CRISPR ACTGTGATGGTATTAGGAGG TGG Intergenic
No off target data available for this crispr