ID: 1170722749

View in Genome Browser
Species Human (GRCh38)
Location 20:18898199-18898221
Sequence TGTGATGGTATTAGGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8226
Summary {0: 112, 1: 652, 2: 1634, 3: 2609, 4: 3219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170722739_1170722749 9 Left 1170722739 20:18898167-18898189 CCAAATCCATGTGTTTAAATGCT No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219
1170722740_1170722749 3 Left 1170722740 20:18898173-18898195 CCATGTGTTTAAATGCTAACCCC No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219
1170722738_1170722749 10 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219
1170722736_1170722749 12 Left 1170722736 20:18898164-18898186 CCCCCAAATCCATGTGTTTAAAT No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219
1170722737_1170722749 11 Left 1170722737 20:18898165-18898187 CCCCAAATCCATGTGTTTAAATG No data
Right 1170722749 20:18898199-18898221 TGTGATGGTATTAGGAGGTGGGG 0: 112
1: 652
2: 1634
3: 2609
4: 3219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170722749 Original CRISPR TGTGATGGTATTAGGAGGTG GGG Intergenic
Too many off-targets to display for this crispr