ID: 1170722750

View in Genome Browser
Species Human (GRCh38)
Location 20:18898206-18898228
Sequence GTATTAGGAGGTGGGGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8264
Summary {0: 185, 1: 784, 2: 1820, 3: 2647, 4: 2828}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170722743_1170722750 -9 Left 1170722743 20:18898192-18898214 CCCCTACTGTGATGGTATTAGGA No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722739_1170722750 16 Left 1170722739 20:18898167-18898189 CCAAATCCATGTGTTTAAATGCT No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722737_1170722750 18 Left 1170722737 20:18898165-18898187 CCCCAAATCCATGTGTTTAAATG No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722736_1170722750 19 Left 1170722736 20:18898164-18898186 CCCCCAAATCCATGTGTTTAAAT No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722744_1170722750 -10 Left 1170722744 20:18898193-18898215 CCCTACTGTGATGGTATTAGGAG No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722740_1170722750 10 Left 1170722740 20:18898173-18898195 CCATGTGTTTAAATGCTAACCCC No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828
1170722738_1170722750 17 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722750 20:18898206-18898228 GTATTAGGAGGTGGGGCCTTTGG 0: 185
1: 784
2: 1820
3: 2647
4: 2828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170722750 Original CRISPR GTATTAGGAGGTGGGGCCTT TGG Intergenic
Too many off-targets to display for this crispr