ID: 1170722751

View in Genome Browser
Species Human (GRCh38)
Location 20:18898218-18898240
Sequence GGGGCCTTTGGTAAATGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170722745_1170722751 1 Left 1170722745 20:18898194-18898216 CCTACTGTGATGGTATTAGGAGG No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722740_1170722751 22 Left 1170722740 20:18898173-18898195 CCATGTGTTTAAATGCTAACCCC No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722738_1170722751 29 Left 1170722738 20:18898166-18898188 CCCAAATCCATGTGTTTAAATGC No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722739_1170722751 28 Left 1170722739 20:18898167-18898189 CCAAATCCATGTGTTTAAATGCT No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722737_1170722751 30 Left 1170722737 20:18898165-18898187 CCCCAAATCCATGTGTTTAAATG No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722744_1170722751 2 Left 1170722744 20:18898193-18898215 CCCTACTGTGATGGTATTAGGAG No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data
1170722743_1170722751 3 Left 1170722743 20:18898192-18898214 CCCCTACTGTGATGGTATTAGGA No data
Right 1170722751 20:18898218-18898240 GGGGCCTTTGGTAAATGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170722751 Original CRISPR GGGGCCTTTGGTAAATGATT AGG Intergenic
No off target data available for this crispr