ID: 1170725164

View in Genome Browser
Species Human (GRCh38)
Location 20:18919682-18919704
Sequence CACAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170725161_1170725164 3 Left 1170725161 20:18919656-18919678 CCAGACACTTGTTCAATAGTTGT No data
Right 1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170725164 Original CRISPR CACAATGCTGATAGTGATAT GGG Intergenic
No off target data available for this crispr