ID: 1170726644

View in Genome Browser
Species Human (GRCh38)
Location 20:18934018-18934040
Sequence TGGAATAATCTCAATAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170726642_1170726644 -5 Left 1170726642 20:18934000-18934022 CCTTCTTTCTCTATCTTTTGGAA 0: 107
1: 439
2: 645
3: 1688
4: 10118
Right 1170726644 20:18934018-18934040 TGGAATAATCTCAATAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170726644 Original CRISPR TGGAATAATCTCAATAGGAT TGG Intergenic
No off target data available for this crispr