ID: 1170727425

View in Genome Browser
Species Human (GRCh38)
Location 20:18942151-18942173
Sequence GAGGGTAAGCTGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2768
Summary {0: 8, 1: 246, 2: 609, 3: 899, 4: 1006}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170727425_1170727437 24 Left 1170727425 20:18942151-18942173 CCACCCTGCTTCAGCTTACCCTC 0: 8
1: 246
2: 609
3: 899
4: 1006
Right 1170727437 20:18942198-18942220 CAGTCCCAGTGAGTTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170727425 Original CRISPR GAGGGTAAGCTGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr