ID: 1170728936

View in Genome Browser
Species Human (GRCh38)
Location 20:18955560-18955582
Sequence GACTCCACCGCAGGATCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170728924_1170728936 -6 Left 1170728924 20:18955543-18955565 CCCCTGCCTTCCCCCCTGACTCC No data
Right 1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG No data
1170728922_1170728936 30 Left 1170728922 20:18955507-18955529 CCAAATACATTTAGGGATGTTGC No data
Right 1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG No data
1170728925_1170728936 -7 Left 1170728925 20:18955544-18955566 CCCTGCCTTCCCCCCTGACTCCA No data
Right 1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG No data
1170728926_1170728936 -8 Left 1170728926 20:18955545-18955567 CCTGCCTTCCCCCCTGACTCCAC No data
Right 1170728936 20:18955560-18955582 GACTCCACCGCAGGATCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170728936 Original CRISPR GACTCCACCGCAGGATCACG GGG Intergenic
No off target data available for this crispr