ID: 1170732672

View in Genome Browser
Species Human (GRCh38)
Location 20:18988240-18988262
Sequence TGCTACATGCTGACCAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170732666_1170732672 25 Left 1170732666 20:18988192-18988214 CCCAGGAAACACAGGCAGTCCAC No data
Right 1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG No data
1170732670_1170732672 6 Left 1170732670 20:18988211-18988233 CCACAGTGGAAGGAACTCAAATT No data
Right 1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG No data
1170732667_1170732672 24 Left 1170732667 20:18988193-18988215 CCAGGAAACACAGGCAGTCCACA No data
Right 1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170732672 Original CRISPR TGCTACATGCTGACCAGGCC CGG Intergenic
No off target data available for this crispr