ID: 1170733440

View in Genome Browser
Species Human (GRCh38)
Location 20:18993399-18993421
Sequence ATGAGAAAGACGAGCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170733440_1170733443 0 Left 1170733440 20:18993399-18993421 CCCTCAGTGCTCGTCTTTCTCAT No data
Right 1170733443 20:18993422-18993444 GTGTGTCAATGGCATCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170733440 Original CRISPR ATGAGAAAGACGAGCACTGA GGG (reversed) Intergenic
No off target data available for this crispr