ID: 1170735986

View in Genome Browser
Species Human (GRCh38)
Location 20:19014640-19014662
Sequence GACTCACGGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170735980_1170735986 16 Left 1170735980 20:19014601-19014623 CCAAGACTGGGTAATTCATAAGG No data
Right 1170735986 20:19014640-19014662 GACTCACGGTTCCACGTGGCTGG 0: 11
1: 635
2: 4748
3: 7908
4: 8118
1170735979_1170735986 17 Left 1170735979 20:19014600-19014622 CCCAAGACTGGGTAATTCATAAG No data
Right 1170735986 20:19014640-19014662 GACTCACGGTTCCACGTGGCTGG 0: 11
1: 635
2: 4748
3: 7908
4: 8118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170735986 Original CRISPR GACTCACGGTTCCACGTGGC TGG Intergenic
Too many off-targets to display for this crispr