ID: 1170736946

View in Genome Browser
Species Human (GRCh38)
Location 20:19021054-19021076
Sequence TCTGTCCATGGTGGTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170736946_1170736961 23 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736961 20:19021100-19021122 GTGTGGAAAGAGAGGCCACAGGG No data
1170736946_1170736959 15 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736959 20:19021092-19021114 GGGATGCTGTGTGGAAAGAGAGG No data
1170736946_1170736954 -6 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736954 20:19021071-19021093 GACAGAAAGGCCCTGGAGGAGGG No data
1170736946_1170736952 -10 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736952 20:19021067-19021089 CATGGACAGAAAGGCCCTGGAGG No data
1170736946_1170736960 22 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736960 20:19021099-19021121 TGTGTGGAAAGAGAGGCCACAGG No data
1170736946_1170736958 6 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736958 20:19021083-19021105 CTGGAGGAGGGGATGCTGTGTGG No data
1170736946_1170736955 -5 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736955 20:19021072-19021094 ACAGAAAGGCCCTGGAGGAGGGG No data
1170736946_1170736953 -7 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736953 20:19021070-19021092 GGACAGAAAGGCCCTGGAGGAGG No data
1170736946_1170736962 26 Left 1170736946 20:19021054-19021076 CCAGTCCAACCACCATGGACAGA No data
Right 1170736962 20:19021103-19021125 TGGAAAGAGAGGCCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170736946 Original CRISPR TCTGTCCATGGTGGTTGGAC TGG (reversed) Intergenic