ID: 1170737827

View in Genome Browser
Species Human (GRCh38)
Location 20:19026555-19026577
Sequence CCCATTAGGCCTCAACTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170737827_1170737841 10 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737841 20:19026588-19026610 TGGGGAAGAGAGAGGGGAAATGG No data
1170737827_1170737838 2 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737838 20:19026580-19026602 GCAGGGGTTGGGGAAGAGAGAGG No data
1170737827_1170737837 -8 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737837 20:19026570-19026592 CTAATGGGGTGCAGGGGTTGGGG No data
1170737827_1170737839 3 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737839 20:19026581-19026603 CAGGGGTTGGGGAAGAGAGAGGG No data
1170737827_1170737834 -10 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737834 20:19026568-19026590 GCCTAATGGGGTGCAGGGGTTGG No data
1170737827_1170737840 4 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737840 20:19026582-19026604 AGGGGTTGGGGAAGAGAGAGGGG No data
1170737827_1170737836 -9 Left 1170737827 20:19026555-19026577 CCTCCTAGTTGAGGCCTAATGGG No data
Right 1170737836 20:19026569-19026591 CCTAATGGGGTGCAGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170737827 Original CRISPR CCCATTAGGCCTCAACTAGG AGG (reversed) Intergenic
No off target data available for this crispr