ID: 1170740403

View in Genome Browser
Species Human (GRCh38)
Location 20:19050944-19050966
Sequence CGAGCCTTACGGATGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170740403_1170740410 14 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740410 20:19050981-19051003 CTGCTGTGCCCTGCAGTGCGGGG No data
1170740403_1170740408 12 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740408 20:19050979-19051001 AACTGCTGTGCCCTGCAGTGCGG No data
1170740403_1170740411 15 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740411 20:19050982-19051004 TGCTGTGCCCTGCAGTGCGGGGG No data
1170740403_1170740414 25 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740414 20:19050992-19051014 TGCAGTGCGGGGGCCTTAACAGG No data
1170740403_1170740409 13 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740409 20:19050980-19051002 ACTGCTGTGCCCTGCAGTGCGGG No data
1170740403_1170740415 26 Left 1170740403 20:19050944-19050966 CCTCCCAGCATCCGTAAGGCTCG No data
Right 1170740415 20:19050993-19051015 GCAGTGCGGGGGCCTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170740403 Original CRISPR CGAGCCTTACGGATGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr