ID: 1170744220

View in Genome Browser
Species Human (GRCh38)
Location 20:19084355-19084377
Sequence AAATCCTGATTCCCAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170744220_1170744222 3 Left 1170744220 20:19084355-19084377 CCTATCTTTGGGAATCAGGATTT No data
Right 1170744222 20:19084381-19084403 TCAGTGAATGCAGACACTTTGGG No data
1170744220_1170744224 5 Left 1170744220 20:19084355-19084377 CCTATCTTTGGGAATCAGGATTT No data
Right 1170744224 20:19084383-19084405 AGTGAATGCAGACACTTTGGGGG No data
1170744220_1170744221 2 Left 1170744220 20:19084355-19084377 CCTATCTTTGGGAATCAGGATTT No data
Right 1170744221 20:19084380-19084402 TTCAGTGAATGCAGACACTTTGG No data
1170744220_1170744223 4 Left 1170744220 20:19084355-19084377 CCTATCTTTGGGAATCAGGATTT No data
Right 1170744223 20:19084382-19084404 CAGTGAATGCAGACACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170744220 Original CRISPR AAATCCTGATTCCCAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr