ID: 1170746963

View in Genome Browser
Species Human (GRCh38)
Location 20:19108147-19108169
Sequence TTTCCAATTCTGAATCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170746963_1170746966 -7 Left 1170746963 20:19108147-19108169 CCACCCAGATTCAGAATTGGAAA No data
Right 1170746966 20:19108163-19108185 TTGGAAAATTACCATTTCCACGG No data
1170746963_1170746969 6 Left 1170746963 20:19108147-19108169 CCACCCAGATTCAGAATTGGAAA No data
Right 1170746969 20:19108176-19108198 ATTTCCACGGCAGCCCCTGTGGG No data
1170746963_1170746968 5 Left 1170746963 20:19108147-19108169 CCACCCAGATTCAGAATTGGAAA No data
Right 1170746968 20:19108175-19108197 CATTTCCACGGCAGCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170746963 Original CRISPR TTTCCAATTCTGAATCTGGG TGG (reversed) Intergenic
No off target data available for this crispr