ID: 1170748410

View in Genome Browser
Species Human (GRCh38)
Location 20:19121490-19121512
Sequence CAGAATTGCCTCCACCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170748410_1170748413 18 Left 1170748410 20:19121490-19121512 CCATCCTGGTGGAGGCAATTCTG No data
Right 1170748413 20:19121531-19121553 GAGCAAACCACCCTATGGTGAGG No data
1170748410_1170748412 13 Left 1170748410 20:19121490-19121512 CCATCCTGGTGGAGGCAATTCTG No data
Right 1170748412 20:19121526-19121548 TATGTGAGCAAACCACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170748410 Original CRISPR CAGAATTGCCTCCACCAGGA TGG (reversed) Intergenic
No off target data available for this crispr