ID: 1170753120

View in Genome Browser
Species Human (GRCh38)
Location 20:19170276-19170298
Sequence ATGGGCTGGCTTTTCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753116_1170753120 -1 Left 1170753116 20:19170254-19170276 CCATCAAGTCATGTCTAAAACTA No data
Right 1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG No data
1170753114_1170753120 12 Left 1170753114 20:19170241-19170263 CCCTCTGTATACTCCATCAAGTC No data
Right 1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG No data
1170753115_1170753120 11 Left 1170753115 20:19170242-19170264 CCTCTGTATACTCCATCAAGTCA No data
Right 1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG No data
1170753113_1170753120 21 Left 1170753113 20:19170232-19170254 CCAAAAGTGCCCTCTGTATACTC No data
Right 1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753120 Original CRISPR ATGGGCTGGCTTTTCTCTCC AGG Intergenic
No off target data available for this crispr