ID: 1170753182

View in Genome Browser
Species Human (GRCh38)
Location 20:19170873-19170895
Sequence TGATTTCCATCCACAAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753178_1170753182 9 Left 1170753178 20:19170841-19170863 CCTAGGGAAAACCAGGTGAAGAC No data
Right 1170753182 20:19170873-19170895 TGATTTCCATCCACAAGCCAAGG No data
1170753181_1170753182 -2 Left 1170753181 20:19170852-19170874 CCAGGTGAAGACACAGGGAGCTG No data
Right 1170753182 20:19170873-19170895 TGATTTCCATCCACAAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753182 Original CRISPR TGATTTCCATCCACAAGCCA AGG Intergenic