ID: 1170753207

View in Genome Browser
Species Human (GRCh38)
Location 20:19171157-19171179
Sequence GACAAGGATGTAAGTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753207_1170753209 -8 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753209 20:19171172-19171194 TCCTTGTCATGGCTTCCTTATGG No data
1170753207_1170753214 24 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753214 20:19171204-19171226 CCTTTCCTGCCCCTTGATTTTGG No data
1170753207_1170753211 -7 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753211 20:19171173-19171195 CCTTGTCATGGCTTCCTTATGGG No data
1170753207_1170753216 30 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753216 20:19171210-19171232 CTGCCCCTTGATTTTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753207 Original CRISPR GACAAGGATGTAAGTACAGC TGG (reversed) Intergenic
No off target data available for this crispr