ID: 1170753209

View in Genome Browser
Species Human (GRCh38)
Location 20:19171172-19171194
Sequence TCCTTGTCATGGCTTCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753207_1170753209 -8 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753209 20:19171172-19171194 TCCTTGTCATGGCTTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753209 Original CRISPR TCCTTGTCATGGCTTCCTTA TGG Intergenic
No off target data available for this crispr