ID: 1170753211

View in Genome Browser
Species Human (GRCh38)
Location 20:19171173-19171195
Sequence CCTTGTCATGGCTTCCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753207_1170753211 -7 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753211 20:19171173-19171195 CCTTGTCATGGCTTCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753211 Original CRISPR CCTTGTCATGGCTTCCTTAT GGG Intergenic
No off target data available for this crispr