ID: 1170753212

View in Genome Browser
Species Human (GRCh38)
Location 20:19171187-19171209
Sequence GAAAGGACACTCTGCCCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753212_1170753216 0 Left 1170753212 20:19171187-19171209 CCTTATGGGCAGAGTGTCCTTTC No data
Right 1170753216 20:19171210-19171232 CTGCCCCTTGATTTTGGCCATGG No data
1170753212_1170753214 -6 Left 1170753212 20:19171187-19171209 CCTTATGGGCAGAGTGTCCTTTC No data
Right 1170753214 20:19171204-19171226 CCTTTCCTGCCCCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753212 Original CRISPR GAAAGGACACTCTGCCCATA AGG (reversed) Intergenic
No off target data available for this crispr