ID: 1170753216

View in Genome Browser
Species Human (GRCh38)
Location 20:19171210-19171232
Sequence CTGCCCCTTGATTTTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170753207_1170753216 30 Left 1170753207 20:19171157-19171179 CCAGCTGTACTTACATCCTTGTC No data
Right 1170753216 20:19171210-19171232 CTGCCCCTTGATTTTGGCCATGG No data
1170753212_1170753216 0 Left 1170753212 20:19171187-19171209 CCTTATGGGCAGAGTGTCCTTTC No data
Right 1170753216 20:19171210-19171232 CTGCCCCTTGATTTTGGCCATGG No data
1170753210_1170753216 14 Left 1170753210 20:19171173-19171195 CCTTGTCATGGCTTCCTTATGGG No data
Right 1170753216 20:19171210-19171232 CTGCCCCTTGATTTTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170753216 Original CRISPR CTGCCCCTTGATTTTGGCCA TGG Intergenic
No off target data available for this crispr