ID: 1170756672

View in Genome Browser
Species Human (GRCh38)
Location 20:19212063-19212085
Sequence CTGTGCCAGGGGAAGAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170756672_1170756681 1 Left 1170756672 20:19212063-19212085 CCGTCCCTCTTCCCCTGGCACAG No data
Right 1170756681 20:19212087-19212109 AGGGTTGAAGGACTGCACACAGG No data
1170756672_1170756682 2 Left 1170756672 20:19212063-19212085 CCGTCCCTCTTCCCCTGGCACAG No data
Right 1170756682 20:19212088-19212110 GGGTTGAAGGACTGCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170756672 Original CRISPR CTGTGCCAGGGGAAGAGGGA CGG (reversed) Intergenic
No off target data available for this crispr