ID: 1170756949

View in Genome Browser
Species Human (GRCh38)
Location 20:19213022-19213044
Sequence CTCCGGCGGCTCGGGGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170756941_1170756949 -4 Left 1170756941 20:19213003-19213025 CCCCGAGTGGGCGCTGCGGCTCC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG 0: 1
1: 0
2: 2
3: 28
4: 252
1170756939_1170756949 0 Left 1170756939 20:19212999-19213021 CCTGCCCCGAGTGGGCGCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG 0: 1
1: 0
2: 2
3: 28
4: 252
1170756943_1170756949 -6 Left 1170756943 20:19213005-19213027 CCGAGTGGGCGCTGCGGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG 0: 1
1: 0
2: 2
3: 28
4: 252
1170756942_1170756949 -5 Left 1170756942 20:19213004-19213026 CCCGAGTGGGCGCTGCGGCTCCG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG 0: 1
1: 0
2: 2
3: 28
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170756949 Original CRISPR CTCCGGCGGCTCGGGGCTCC CGG Intronic
900001009 1:14870-14892 CTCCGGGGGCTGGGGGAACCAGG - Intergenic
900020724 1:185391-185413 CTCCGGGGGCTGGGGGAACCAGG - Intergenic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900171931 1:1273577-1273599 CAGCGGCGGCCCGGGGCTGCTGG - Intronic
900349511 1:2228076-2228098 CGGCGGCGGCGCGGGGCTCGGGG - Intergenic
900356669 1:2268294-2268316 CTCAGAGGGCTCAGGGCTCCTGG + Intronic
900513045 1:3069393-3069415 CGCCTGCGGCTCCGGGCCCCCGG + Intronic
900529976 1:3148360-3148382 CTCCTGCAGCTCCTGGCTCCTGG - Intronic
901461501 1:9394649-9394671 CTCTCTCGGCTCGGGGCCCCTGG + Intergenic
901684945 1:10938679-10938701 CTCAAGCAGCTGGGGGCTCCGGG + Intergenic
902323731 1:15684743-15684765 CTCTACCGGCCCGGGGCTCCCGG - Intronic
902405980 1:16183837-16183859 CTCAGCCAGCCCGGGGCTCCAGG - Intergenic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
902744347 1:18463498-18463520 GGCCGGCGTCCCGGGGCTCCTGG + Intergenic
902759382 1:18571286-18571308 CTACGGGGTCTGGGGGCTCCAGG - Intergenic
903658977 1:24965525-24965547 CTCCGGCCGCTGGTGGATCCGGG - Intergenic
904080953 1:27872427-27872449 CTTCGGCGGGGCGGGGCTGCAGG + Intergenic
904237098 1:29122986-29123008 CTCCTGCGGCCTGGGGCGCCTGG - Intronic
905416500 1:37808043-37808065 CTCCGGCGGCCCCCGGCGCCCGG - Exonic
906293037 1:44632158-44632180 CTCCGGCCGCTCCGGGCTCTCGG - Intronic
906314191 1:44775766-44775788 CTGCGAAGGCTCTGGGCTCCGGG + Intronic
906480874 1:46198252-46198274 CTCGGGCGGCTCCGGGCCCTGGG - Intronic
907385396 1:54122380-54122402 CTCGGGCTGCTCGGAGCTGCAGG + Intergenic
913300763 1:117367039-117367061 CTCCGGTGGCTCGCAGCTGCTGG - Intergenic
916528219 1:165631318-165631340 CCCCGGCGGCCCGGTGCTCGTGG - Intronic
916792611 1:168136991-168137013 GGGAGGCGGCTCGGGGCTCCGGG - Intronic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
920190492 1:204190646-204190668 GCCCGGCTGCTGGGGGCTCCCGG + Exonic
920409674 1:205749655-205749677 CTCCGGCCGCTGGCGGCTCAGGG + Intronic
921039541 1:211416677-211416699 CTCCGGCCGCCCGGGGCCCCCGG - Intergenic
922125087 1:222713425-222713447 CTCTGGGGACTCGGGGCTTCCGG + Intronic
923107838 1:230868254-230868276 CCCCGGGGTCTCGGGGCGCCGGG + Exonic
923484141 1:234412997-234413019 TTCCGGCGGGTCGGGGGTCGAGG - Intronic
924415128 1:243850200-243850222 CGCCGGCCGCACCGGGCTCCAGG - Intronic
924554305 1:245105509-245105531 CTCAGGGGGCTCAGGGCTCAGGG + Intronic
1070503313 10:77091388-77091410 CTCCAACCGCTCGGGGCTCCTGG + Intronic
1072685659 10:97535063-97535085 CTCTGGAGGCTGGGGGCTTCTGG + Intronic
1073363608 10:102919083-102919105 CGCCGGCGGCTCGGGGTCCACGG + Exonic
1073540834 10:104315346-104315368 CTCCGGCCGCTCAGTGCCCCTGG - Exonic
1074814579 10:117134650-117134672 CTCCCGGGGCGCGCGGCTCCGGG + Intronic
1075587115 10:123666192-123666214 GTGAGGCGGCGCGGGGCTCCCGG + Intergenic
1075630153 10:123995723-123995745 CTGGGGCGGCTCGAGGTTCCTGG + Intergenic
1076358588 10:129870494-129870516 CCCTGGCAGCTCGGGGCCCCAGG - Intronic
1076488192 10:130837703-130837725 CTCCAGCTGCTGGTGGCTCCAGG - Intergenic
1076732365 10:132445095-132445117 CTCCGGTGGCTCTGGCCTCTGGG + Intronic
1081007036 11:37757317-37757339 CTTCTGGTGCTCGGGGCTCCAGG + Intergenic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1082083906 11:48033355-48033377 CTCCCTCAGCTCCGGGCTCCTGG - Intronic
1083610049 11:64000233-64000255 CACCGGCGGCTATCGGCTCCCGG - Exonic
1083955634 11:65981500-65981522 CTCTGGGGGCTCAGGCCTCCAGG - Intergenic
1084646841 11:70463821-70463843 CTACGGCGGCTCTCGGGTCCTGG + Intergenic
1085044825 11:73346741-73346763 CTCCTGCCGCCCAGGGCTCCGGG - Intronic
1086953777 11:92915719-92915741 CTACAGCGGCTCGCGCCTCCAGG + Intergenic
1087950170 11:104211496-104211518 GTCAGGGGGCTCGGGGCTCGGGG - Intergenic
1089383416 11:118052268-118052290 CTACGGCTGCTCAGGACTCCAGG + Intergenic
1091446441 12:546420-546442 ATCCGGCTGCTCCGGGCTCCTGG + Intronic
1091622729 12:2101546-2101568 CTCCTGAGGCTCGGAGCTCACGG - Intronic
1092820621 12:12350344-12350366 CCGCGGAGGCTCCGGGCTCCCGG + Exonic
1095099265 12:38163611-38163633 CTCGGCCGGCTCGGGGATCCCGG - Intergenic
1096491480 12:52015283-52015305 CTCCCGCTGCTCTGGGCTCCTGG - Exonic
1096792769 12:54055150-54055172 CTCCGGCGGCGTGGCGCTCTGGG - Exonic
1097263328 12:57731880-57731902 CTGCCTCGGCTCGGAGCTCCCGG + Exonic
1098893355 12:76031538-76031560 GCCCGGCAGCTCGGAGCTCCGGG - Exonic
1103261615 12:119593736-119593758 AGCCAGCGGCTCGGGGCTCAAGG - Exonic
1103400569 12:120640643-120640665 CGCCGGGAGCTCCGGGCTCCGGG + Exonic
1103562566 12:121800208-121800230 CCCCCGAGGCGCGGGGCTCCCGG - Intronic
1103562865 12:121801151-121801173 AGCCGGCTTCTCGGGGCTCCGGG - Intronic
1103813349 12:123633580-123633602 CGCGGGCGGCTCGGGTCCCCTGG - Exonic
1104887134 12:132117321-132117343 CTCCGGGGGCTCCGTGCTCCTGG - Intronic
1106190833 13:27450989-27451011 CCCCGGTGGCGCGCGGCTCCCGG + Intergenic
1106517207 13:30465555-30465577 CTCGCGGGGCGCGGGGCTCCCGG + Intronic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1112318916 13:98389496-98389518 CGCCCACGGCTCCGGGCTCCAGG - Intronic
1113906937 13:113823717-113823739 CCCCGGTGCCTCTGGGCTCCGGG - Intronic
1113983457 13:114295420-114295442 CTCCAGCGGCTCTGGCCTGCTGG + Intronic
1114519016 14:23321507-23321529 CTGCGGGCGGTCGGGGCTCCGGG + Exonic
1119382879 14:74239977-74239999 AGCCGACGGCGCGGGGCTCCCGG - Intronic
1121546961 14:94769805-94769827 CCCCGGCGGCGCGGGCCTCCCGG - Exonic
1122082277 14:99274257-99274279 CGCCGGCGGCGCTGGGCTGCAGG - Intergenic
1122354355 14:101114221-101114243 CTCCGGGACCTGGGGGCTCCAGG - Intergenic
1122386514 14:101351931-101351953 CTCCGGTGGCTCGCGTCTTCAGG - Intergenic
1122889047 14:104724216-104724238 CGCCGGCGGCGGCGGGCTCCTGG + Intronic
1123710025 15:22980293-22980315 CCGCGGCGGCTTGGGGGTCCTGG + Exonic
1125003632 15:34795530-34795552 CTCCGGCGGCAGCGGGCTCTGGG + Exonic
1128028652 15:64460789-64460811 CTCCGCCCGCCCGGGGCCCCGGG - Intronic
1129853762 15:78810586-78810608 CCCTGGCGGCTCGGGGGGCCGGG - Intronic
1130305792 15:82711403-82711425 CTCAGGAGGCTGTGGGCTCCTGG - Intergenic
1130720877 15:86385039-86385061 CTCAGGAGGCTCGTGGCTGCCGG - Intronic
1130784718 15:87083450-87083472 CTCCTGCTCCTCGAGGCTCCAGG - Intergenic
1131033729 15:89207298-89207320 ACCTGGCAGCTCGGGGCTCCGGG + Intergenic
1132452501 15:101976070-101976092 CTCCGGGGGCTGGGGGAACCAGG + Intergenic
1132454397 16:14552-14574 CTCCGGGGGCTGGGGGAACCAGG - Intronic
1132568238 16:632904-632926 CTCCGGCGGCCCCGGGCTGCTGG - Exonic
1132623240 16:878182-878204 CTGCAGCTGCTCAGGGCTCCTGG - Intronic
1132643139 16:987132-987154 CCCCTGCCGCTCGGGGGTCCGGG - Intergenic
1132657619 16:1047981-1048003 GTGCCGCGGCTAGGGGCTCCTGG + Intergenic
1132683677 16:1153646-1153668 CTCCCGCGGCGCGGAGCTGCGGG - Intronic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133756733 16:8767529-8767551 CTCCAGCTGCTGGGGACTCCTGG - Intronic
1134091122 16:11392227-11392249 CCCCAAGGGCTCGGGGCTCCTGG + Intronic
1134290825 16:12901951-12901973 CCGCGGCGGCTCGCAGCTCCCGG + Exonic
1136498851 16:30659744-30659766 CGCCGGCGTCTCGGGCCCCCAGG - Exonic
1136569036 16:31085989-31086011 CTCCGGGGTCTCTGGGCTCTGGG + Exonic
1137984988 16:53099851-53099873 CTCCCGCTGCCCGGGGCGCCTGG - Intronic
1138507700 16:57486400-57486422 CGGCGGCGGCGCCGGGCTCCAGG + Exonic
1139095821 16:63703656-63703678 CTGCGGCCGCTCGGAGATCCTGG + Intergenic
1139910335 16:70393707-70393729 CTCAGGTGGCTCCGGGGTCCTGG + Intronic
1141423957 16:83933718-83933740 CTCCGGCTTCAGGGGGCTCCAGG + Intronic
1141840046 16:86568295-86568317 CCCCGGCGGCCCCGGCCTCCAGG - Exonic
1142006055 16:87690057-87690079 CTCCCGCGGCTTGGGGTTCCCGG - Exonic
1142611141 17:1109647-1109669 CTCCGGCGCATGGGGACTCCGGG - Intronic
1143109283 17:4544433-4544455 CTCCTGCGCCTGGGGGCTGCCGG + Intronic
1144500839 17:15786216-15786238 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1144909899 17:18672492-18672514 CGGGGGCGGCTGGGGGCTCCGGG - Intronic
1144963322 17:19059334-19059356 CTCCGGCGTCTGGAGGCTACTGG + Intergenic
1144964368 17:19066706-19066728 CTCCGGCGTCTGGAGGCTACTGG - Intergenic
1144971837 17:19115191-19115213 CTCCGGCGTCTGGAGGCTACTGG - Intergenic
1144983598 17:19185438-19185460 CTCCGGCGTCTGGAGGCTACTGG + Intergenic
1144984627 17:19192801-19192823 CTCCGGCGTCTGGAGGCTACTGG - Intergenic
1145163000 17:20588878-20588900 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1146053164 17:29568089-29568111 CTCCGGCCTCCCGGGGCTTCTGG + Intronic
1146142332 17:30378928-30378950 CTCCCGCGGCTCAGCGCTCCGGG - Exonic
1146183166 17:30709752-30709774 CTCCTGCGGCTCGGCGAACCCGG - Intergenic
1146935164 17:36808585-36808607 AGCCGGGGGCGCGGGGCTCCAGG + Intergenic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1149293346 17:55238361-55238383 GTCCTGCAGCTAGGGGCTCCTGG - Intergenic
1150217010 17:63476692-63476714 CTCCGGAGGCGGGAGGCTCCGGG + Intergenic
1150809698 17:68346853-68346875 CTCAGGCTTCTCCGGGCTCCTGG + Intronic
1151487594 17:74411062-74411084 CTCCAGCTTCTGGGGGCTCCAGG - Intergenic
1151783780 17:76265416-76265438 GGCCGGCCGCCCGGGGCTCCGGG - Exonic
1151869151 17:76824788-76824810 CTCCAGCATCTGGGGGCTCCAGG + Intergenic
1152137107 17:78510991-78511013 CTCCAGCTTCTGGGGGCTCCAGG - Intronic
1152259120 17:79257241-79257263 CTCCCGGGGCTCGGGGCTTGGGG - Intronic
1152342645 17:79733755-79733777 CTCCAGGGTCTCGGGGCTCCTGG + Intronic
1153515166 18:5895444-5895466 CGGCGGCGGCTCGGGGCGGCCGG + Exonic
1155257745 18:24014076-24014098 GTCCCGCAGCGCGGGGCTCCGGG + Intronic
1157867183 18:51197194-51197216 CTCGGGCGGCCCGGAGCTCGAGG - Exonic
1158976689 18:62716430-62716452 CGGCGGCGGCTCCGGGCCCCTGG - Exonic
1159004594 18:63001248-63001270 CTCCAGCTGCTGGCGGCTCCCGG + Intergenic
1160017775 18:75157616-75157638 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1160025416 18:75211741-75211763 CCCCGCGGGCTCCGGGCTCCGGG - Intronic
1160540252 18:79617199-79617221 CTCCGGCTTCTCGGGGCCACGGG - Intergenic
1160739756 19:680350-680372 GCCCGACTGCTCGGGGCTCCCGG + Exonic
1160876790 19:1300152-1300174 CCCCGGCCCCTCGGGCCTCCGGG - Exonic
1161210300 19:3062249-3062271 CTCGGGCTGCTGGGGGCGCCGGG + Intronic
1161304073 19:3557376-3557398 CTCCGGCCGCTGGGGGTCCCGGG + Exonic
1161439874 19:4284847-4284869 CTCCGCAGGCTGGGGGCTTCTGG - Exonic
1161556263 19:4944455-4944477 CTGCAGCGTCCCGGGGCTCCAGG + Intronic
1161594792 19:5145704-5145726 CTCCCCTGGCTCGAGGCTCCCGG + Intronic
1161610592 19:5240250-5240272 CTCCTGCCGCGGGGGGCTCCAGG + Exonic
1162267096 19:9584569-9584591 CTCGGGCCGGGCGGGGCTCCTGG + Intergenic
1162278224 19:9675122-9675144 CTCCGGCCGGGTGGGGCTCCAGG + Intergenic
1162932041 19:13962259-13962281 CTGCGCCGGCCCGGGGCTCAGGG + Exonic
1162975628 19:14206022-14206044 CTCCTGCGGCTCGGCGAACCCGG + Exonic
1163117298 19:15196161-15196183 CTCCGGGCGATCCGGGCTCCGGG + Intronic
1163577259 19:18118075-18118097 GTCCGGCTCCGCGGGGCTCCTGG + Intronic
1163686555 19:18715123-18715145 CTCCTGCCTCTGGGGGCTCCCGG + Intronic
1163755281 19:19102964-19102986 TTCCGGCTTCTGGGGGCTCCTGG + Intronic
1163760344 19:19133039-19133061 CTCAGGGGGCTCTGGGCTCAGGG - Intronic
1166359820 19:42248464-42248486 CTCAGGAGTCTCGGTGCTCCAGG + Exonic
1166520261 19:43475351-43475373 CTCCGCCGGCGCGGGGCGCGGGG - Exonic
1167437193 19:49486344-49486366 CAGCGCCGGCCCGGGGCTCCAGG - Intergenic
925389860 2:3487300-3487322 TTCCGGCCTCTGGGGGCTCCCGG + Intergenic
926422868 2:12716652-12716674 CTTCCGCGGCCCGGGGCCCCGGG - Intergenic
927498095 2:23564067-23564089 AACCGACTGCTCGGGGCTCCAGG + Intronic
927651762 2:24917741-24917763 CTCCGGGAGCTCGGGGTGCCTGG - Intronic
927990335 2:27442742-27442764 CTCTGTCGGCTCGGGGCTGCTGG + Exonic
928140780 2:28727076-28727098 CTCCGGCTGCTCTGTGATCCTGG + Intergenic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
932770906 2:74500266-74500288 CTCCTGCGGCCCGGGTCTCCCGG - Intronic
934761259 2:96858263-96858285 CTCCAGCGGCGCGCGGCTCCCGG - Intergenic
935716548 2:105944127-105944149 CTCTAGGGGGTCGGGGCTCCTGG - Intergenic
936568712 2:113598544-113598566 CTCCGGGGGCTGGGGGAACCAGG + Intergenic
942459454 2:176159338-176159360 TTCTGGGGGCTCGGGCCTCCAGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
943645997 2:190408419-190408441 GGGCGGCGGCTCGGGGCGCCGGG - Exonic
946767342 2:223052890-223052912 CGCCGGCCGCACGGGACTCCAGG - Exonic
947635583 2:231679286-231679308 CTCATGGGGCTCGGGGCTCATGG + Intergenic
947674084 2:231961735-231961757 CTGCGGCGGCGCCGGCCTCCGGG + Exonic
1169048781 20:2559012-2559034 CTCCAGCGCCTCGTGGCACCCGG + Intronic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1171958139 20:31475311-31475333 CTCCAGCGGCTGGATGCTCCAGG - Exonic
1173495452 20:43514684-43514706 CTGCCGCAGCTCGGGGCTCGGGG - Exonic
1173516207 20:43667177-43667199 CTCCGGCCGCTCCGGGCCCCGGG - Exonic
1174569532 20:51491990-51492012 CTCCGGGGGCGCGGGGCTGGGGG - Intronic
1175267360 20:57710499-57710521 CTCCAGCAGCTCGGGGATCATGG + Intronic
1175715664 20:61252941-61252963 CTCCCGCGGCGCGCGGCTCCCGG - Intronic
1176173581 20:63707508-63707530 CGCCGGTGGCTCGCTGCTCCCGG - Intronic
1176253720 20:64139686-64139708 CTCCGGCAGCTGTGGGCCCCAGG + Intergenic
1179596226 21:42444755-42444777 CTCCGGGGGCACGTGGATCCTGG - Intronic
1180867529 22:19127924-19127946 CTCCCTCGCCTCTGGGCTCCAGG + Intergenic
1183444440 22:37843925-37843947 CACCGGCGGCTCGGGCCCACGGG - Exonic
1184379185 22:44134402-44134424 CTACGTCAGCTCGGGGCCCCAGG + Intronic
1184766972 22:46577181-46577203 CCCCGGCGCCGCTGGGCTCCCGG + Intronic
1185278715 22:49960909-49960931 CGCCTGGGGCTCGGGGCTCCGGG + Exonic
952929345 3:38347207-38347229 CTCCGGCCCCTCTGGGCACCGGG - Intronic
953925388 3:46979987-46980009 CCCCAGCGGCGCGGGGCGCCAGG - Intronic
954420197 3:50414833-50414855 GGCCGGCGGCGCAGGGCTCCGGG + Intronic
954538595 3:51379454-51379476 CTCCAGCTGCTGGGGGCTGCTGG - Intronic
954632793 3:52056289-52056311 CGGCGGCGGCTGGGGGCACCCGG - Exonic
955281158 3:57596573-57596595 CCCGGGCGGCTCCAGGCTCCGGG + Intronic
960047433 3:113211668-113211690 CACCGGCGGGCCGGGGCTCAGGG - Exonic
960914279 3:122680924-122680946 CTTCGGGGGGTCGGGGCCCCAGG - Exonic
961161480 3:124730419-124730441 CGCCGGAGGCCCGGGGCGCCTGG + Exonic
961815350 3:129547414-129547436 CTGCTGTGGCTCGGGCCTCCTGG - Exonic
962362692 3:134755250-134755272 CTCCAGGGGCTCAGGGCTCAGGG - Intronic
963081876 3:141402323-141402345 CGCCGGCGGCTCGGCTCTGCCGG - Intronic
968230385 3:197002215-197002237 CTGCGGGGGCTCGGGGATGCTGG - Exonic
968756420 4:2418461-2418483 CGCCGCCCGCTCGGCGCTCCGGG - Exonic
969114038 4:4860300-4860322 CTCGGGCTTCTCGGGGCTCTCGG - Exonic
969718024 4:8877766-8877788 CCCCGGCGGTTCCAGGCTCCAGG - Intergenic
971030790 4:22634934-22634956 CTCGCGCGGCGCGGGGCACCCGG - Intergenic
975661098 4:76689652-76689674 CCCGGGCTGCTCGGGGCTCCAGG - Intronic
976431355 4:84966335-84966357 GGCCCGCGGCGCGGGGCTCCCGG - Exonic
976729189 4:88245057-88245079 CTGCTTCAGCTCGGGGCTCCTGG - Intergenic
977908240 4:102501505-102501527 CCTCGGCGGCGCTGGGCTCCGGG - Exonic
979624153 4:122827134-122827156 CTCCAGCGGCTCGGGGATCCCGG + Exonic
984973440 4:185209971-185209993 CTCCGGCCGCCCGGGGCCCCCGG - Intronic
985515833 5:344140-344162 CGCCGGGGGCTCCGGGCACCGGG - Intronic
985550184 5:528786-528808 CTCCCCCCGCCCGGGGCTCCGGG + Intergenic
985836325 5:2274810-2274832 CTCCGGGGTTCCGGGGCTCCGGG + Intergenic
986279925 5:6314508-6314530 CTCCAGCTGCTGGTGGCTCCTGG - Intergenic
986293951 5:6422202-6422224 CTCTGGCGTCTGGGGGCTCCCGG - Intergenic
986622586 5:9691285-9691307 TTCCGGCTTCTGGGGGCTCCAGG - Intronic
996308561 5:122077860-122077882 CGCCGGCGGCTCCGGGCGCCTGG - Exonic
999279773 5:150357615-150357637 CTCCGGCCGCGCGGCGCGCCGGG - Intergenic
999696091 5:154190162-154190184 CCCCGGCGACTCGGTGTTCCCGG - Intronic
1001948073 5:175796918-175796940 CGCCGGCGGCTGAGAGCTCCAGG - Intronic
1002603162 5:180366454-180366476 CTCCGGCCACTCTGGGCTCCGGG - Intergenic
1002795215 6:466262-466284 CTCCCGCCTCCCGGGGCTCCAGG - Intergenic
1003318341 6:5031308-5031330 CTTCGGTTGCTCGGGCCTCCAGG - Intergenic
1003324937 6:5084584-5084606 CTCCGGCCGCTCTCGGCTGCGGG + Exonic
1004705715 6:18122228-18122250 CTTCGGCGGCTGGGGGACCCTGG - Exonic
1005328008 6:24720800-24720822 CTCGGGCGCCTCGCGGGTCCGGG + Exonic
1006173504 6:32108696-32108718 CTCTGGGGGCTCCAGGCTCCAGG - Intronic
1006519993 6:34565780-34565802 CTCCTCCTGCTCTGGGCTCCAGG + Intergenic
1011193981 6:84763887-84763909 CACCCGCGGCTCCGCGCTCCAGG + Exonic
1013273415 6:108561621-108561643 CGGGGGCGGCTGGGGGCTCCGGG + Exonic
1013908934 6:115250769-115250791 GTTAGGCTGCTCGGGGCTCCAGG - Intergenic
1014674546 6:124348259-124348281 CTCAGGCTGCTCGGGGGTCAGGG + Intronic
1019634047 7:2066192-2066214 CTCCGGCTGGTGGGGGCTCTGGG - Intronic
1019644872 7:2123739-2123761 CTCCGGCGGCGTGGTGCTGCAGG + Intronic
1019903704 7:4044285-4044307 CTACCGCTGCTCAGGGCTCCCGG + Intronic
1020105781 7:5421675-5421697 CGCCGGCGGCTTCAGGCTCCCGG + Intronic
1023881828 7:44325231-44325253 CGCCGGCTTCTCTGGGCTCCGGG - Intronic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1025697921 7:63789711-63789733 CGCCGGCCGATCGGGCCTCCAGG + Intergenic
1030235332 7:107253756-107253778 CTCCAGCCACTCGGGCCTCCTGG + Intronic
1032344450 7:131106210-131106232 CTCCGGCGGCCCGCCGCCCCCGG + Intergenic
1033253210 7:139777846-139777868 CGCGGGGGGCTCGGGGCTCGGGG + Intronic
1037273746 8:17156547-17156569 CCGCGCCGGCTCGGGGCTGCGGG + Exonic
1040850830 8:51899080-51899102 CCCCGGCGGCTCCGGAGTCCGGG - Exonic
1041839291 8:62249403-62249425 CTCCGCCGGCTCCTGGCCCCTGG - Intronic
1042155729 8:65842135-65842157 CTGCGGCGGCGCGGGGCGCTGGG - Intronic
1043873820 8:85463775-85463797 CTCCGGGGCTCCGGGGCTCCGGG - Intergenic
1049796939 8:144501221-144501243 CTCGGGCGGCTCCGGGCTGGTGG - Exonic
1049798975 8:144509080-144509102 CACCGGCGGCCGGCGGCTCCCGG - Exonic
1049883815 9:14981-15003 CTCCGGGGGCTGGGGGAACCAGG - Intergenic
1053066318 9:35071991-35072013 CTCCGCCGGCGCGGCGCCCCGGG - Intronic
1057490576 9:95516736-95516758 CTCCGGCGGCCCAGCGCGCCGGG - Intronic
1057548069 9:96032683-96032705 CTCTGCCAGCTCCGGGCTCCTGG - Intergenic
1057801245 9:98192637-98192659 CGGCGGCGGCTCTGGGCGCCGGG - Intronic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060106627 9:120876952-120876974 CTCCTGCGGAGCGGGGCTCTCGG - Intronic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1061016038 9:127981142-127981164 CAGAGGCGGCTCGGGGCTCTCGG + Intergenic
1061129921 9:128702999-128703021 CGGCCGCGGTTCGGGGCTCCGGG - Intronic
1061285544 9:129620425-129620447 CTCTGGGCGCGCGGGGCTCCGGG - Exonic
1061415380 9:130444679-130444701 CGCAGGCGGCTCGCGGTTCCTGG - Intergenic
1061839385 9:133348705-133348727 CTCTGGCCACTCGGGGTTCCCGG + Intronic
1062165329 9:135104755-135104777 CTCCGGCTGCTGGGGGGCCCTGG - Intronic
1062261739 9:135666284-135666306 TTCCGGCTGCTGGGGGCTCCAGG + Intronic
1062362083 9:136193030-136193052 CCCCCGCGGCTGGGGTCTCCCGG - Intergenic
1062402432 9:136378449-136378471 CTCGGGCGGCCCAGGGCCCCAGG - Exonic
1062522030 9:136961905-136961927 ATGCGGGGACTCGGGGCTCCTGG + Intergenic
1062579576 9:137223345-137223367 CTGCGGCGGAGCTGGGCTCCCGG - Intergenic
1185621966 X:1455480-1455502 CTCCCGCTCCTGGGGGCTCCAGG + Intergenic
1185888203 X:3801832-3801854 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1187391808 X:18891062-18891084 CACCCCCGGCTCGAGGCTCCAGG + Intergenic
1189532615 X:41902006-41902028 CCCTGGCGGATCCGGGCTCCAGG - Intronic
1192361792 X:70445265-70445287 CTGCGGCGCCTCGAGCCTCCGGG + Exonic