ID: 1170757232

View in Genome Browser
Species Human (GRCh38)
Location 20:19214790-19214812
Sequence ATGCGGAAAAGGCCGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170757232 Original CRISPR ATGCGGAAAAGGCCGTGCTA TGG (reversed) Intronic
900664690 1:3806950-3806972 ATTCAGAAAAGACTGTGCTATGG + Intergenic
901621826 1:10594731-10594753 CTGCGGGACAGGCCGTGCAAGGG - Intronic
902056616 1:13605967-13605989 ATGCGGAAAAGCCAGGGCCAAGG + Intronic
911151035 1:94596863-94596885 ATGTGGAGAATGCTGTGCTATGG - Intergenic
915258415 1:154654514-154654536 ATGCAGCAAAAGCAGTGCTAAGG - Intergenic
918077862 1:181183992-181184014 ATGAGGAAGGGGCCGTGCCATGG - Intergenic
1064297785 10:14094023-14094045 TTGCCGAAAAGGCCGTGGCAAGG + Intronic
1070021526 10:72591214-72591236 ATGCAGCAAAAGCAGTGCTAAGG + Intronic
1079568878 11:21917606-21917628 ATCCAGAAAAGACAGTGCTATGG + Intergenic
1084043373 11:66555434-66555456 AGGAGGAAAGGGCCGTGCAAAGG - Intronic
1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG + Intergenic
1094263544 12:28528229-28528251 AGGCAGAAAATGCCTTGCTAGGG + Intronic
1101121732 12:101588062-101588084 ATGTGGTGAAGGCAGTGCTAAGG + Intronic
1104524359 12:129504865-129504887 ATACAGCAAAGGCAGTGCTAAGG - Intronic
1108135134 13:47348440-47348462 ATGCGTAAAAACCTGTGCTATGG - Intergenic
1112336050 13:98517031-98517053 ATGCAGTAAAGATCGTGCTAAGG + Intronic
1118541618 14:66833966-66833988 ATGATGAAAAGGGCATGCTAGGG - Intronic
1120545509 14:85806794-85806816 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
1120720800 14:87888133-87888155 AGGGAGAAAAGGCCGTTCTATGG + Intronic
1125384102 15:39118133-39118155 ATGCAGCAAAGGCAGTGTTAAGG + Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1152829407 17:82487958-82487980 ATGCGGATAAGGCCCTGCTGCGG + Exonic
1155771577 18:29707412-29707434 ATACGGCAAAAGCAGTGCTAAGG - Intergenic
1158830077 18:61267083-61267105 ATACAGCAAAGGCAGTGCTAAGG + Intergenic
925289584 2:2738493-2738515 ATGCACCAAAGGCCGTGCGATGG - Intergenic
928023464 2:27721578-27721600 ATGCGGACAAGGCCCTGTGAAGG + Intergenic
931012462 2:57932838-57932860 ATGCAGCAAAAGCAGTGCTAAGG - Intronic
933443213 2:82341545-82341567 ATGAGGAAATGGCCATGCTGTGG + Intergenic
933945887 2:87285926-87285948 GTGAGGAAATGGCCGTGCAAAGG + Intergenic
934737776 2:96698662-96698684 ATGCGGAAAAGGCCCTGGCGGGG - Intergenic
936334325 2:111575660-111575682 GTGAGGAAATGGCCGTGCAAAGG - Intergenic
937647658 2:124283986-124284008 AAGAGGAAAAGCCCCTGCTATGG - Intronic
939482896 2:142771393-142771415 ATGTGGAAAAGGCCTTTGTAGGG + Intergenic
943500686 2:188685465-188685487 ATGCAGCAAAGGCAGTGTTAAGG - Intergenic
945462377 2:210124484-210124506 ATGCAGTGAAGGCAGTGCTAAGG + Intronic
1170757232 20:19214790-19214812 ATGCGGAAAAGGCCGTGCTATGG - Intronic
1181364220 22:22362609-22362631 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
1182486721 22:30643531-30643553 ATGGGAAACAGGCCGTGCCAGGG + Intronic
952536940 3:34321245-34321267 ATGGGGAAAATGTCGTCCTAGGG - Intergenic
959217958 3:103477879-103477901 ATGCAGCAAATGCAGTGCTAAGG + Intergenic
961407422 3:126691222-126691244 ATATGGCAAAGGCAGTGCTAAGG + Intergenic
979498884 4:121416297-121416319 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
993221930 5:85110384-85110406 ATGCGGGAGAGGCTGTGTTAGGG + Intergenic
999180251 5:149665136-149665158 TTGCTGAAAAGGCAGTTCTAGGG - Intergenic
1005475016 6:26199201-26199223 AGGCGGAAAGGCCCGAGCTAAGG - Exonic
1005807680 6:29490303-29490325 ATGAGGATAAGACAGTGCTAAGG + Intergenic
1006890344 6:37421693-37421715 ATGCAGCAAAAGCAGTGCTAAGG - Intergenic
1015222404 6:130819252-130819274 ATACAGCAAAGGCGGTGCTAAGG + Intergenic
1027761044 7:82279056-82279078 ATGCAGAAAAGTCAGTGCCAAGG + Intronic
1030253432 7:107478121-107478143 ATGCGGAATAAGCCCTACTAAGG - Intronic
1031438157 7:121758665-121758687 ATGCAGAAAAAGCAGTGCTGAGG + Intergenic
1037755178 8:21705809-21705831 ATGCAGAGAAGGCCGGGCTCAGG + Intronic
1049648289 8:143747515-143747537 ATGCAGCAAAAGCAGTGCTAAGG - Intergenic
1052621931 9:30923447-30923469 ATGCTGAAATGTCCCTGCTAGGG - Intergenic
1189552704 X:42110262-42110284 ATGCTGAACAGCCAGTGCTACGG + Intergenic
1196282020 X:113833045-113833067 CTGCCTAAAAGGCAGTGCTATGG - Intergenic
1198005985 X:132493050-132493072 ATTCAGGCAAGGCCGTGCTATGG + Intergenic