ID: 1170757928

View in Genome Browser
Species Human (GRCh38)
Location 20:19221226-19221248
Sequence CTGCACATATTGAGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170757928_1170757933 12 Left 1170757928 20:19221226-19221248 CCATCTCCTCTCAATATGTGCAG 0: 1
1: 0
2: 1
3: 20
4: 196
Right 1170757933 20:19221261-19221283 TTCCAGCACGTCTTCTTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1170757928_1170757932 9 Left 1170757928 20:19221226-19221248 CCATCTCCTCTCAATATGTGCAG 0: 1
1: 0
2: 1
3: 20
4: 196
Right 1170757932 20:19221258-19221280 GTATTCCAGCACGTCTTCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170757928 Original CRISPR CTGCACATATTGAGAGGAGA TGG (reversed) Intronic
902131834 1:14268501-14268523 CAGCACAGATTGAGAGGAAGGGG + Intergenic
902325165 1:15695366-15695388 CTGAACATGTTGAGAGGAAGGGG + Intronic
903933267 1:26876834-26876856 CTGCACCCATGGAGTGGAGATGG - Exonic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
907800605 1:57761622-57761644 CTGCTCGTATTTAGAGGGGAGGG - Intronic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
907872670 1:58457101-58457123 CTGTGCAAAATGAGAGGAGATGG - Intronic
908469437 1:64428812-64428834 CATAACATATTAAGAGGAGAAGG - Intergenic
910625049 1:89297626-89297648 CTGCACATGATGGAAGGAGAAGG - Intergenic
910642503 1:89479225-89479247 ATGGACATATTGAGGGGATATGG + Intergenic
915670113 1:157481820-157481842 CTGCACATATGGTAAGGTGAGGG + Intergenic
916633040 1:166637761-166637783 CTGCTCTTACTGAGAGAAGAAGG + Intergenic
917569802 1:176253202-176253224 TTGCACATATTTAGAGGATACGG + Intergenic
917690143 1:177460331-177460353 CAGCATATACTGACAGGAGATGG - Intergenic
918137914 1:181692621-181692643 TTGCATATATTGAGAGGTAAGGG - Intronic
919470545 1:197973691-197973713 CTGGACATATTGAGAGTTGGCGG + Intergenic
920565007 1:206966058-206966080 CTGCCTAGATTGGGAGGAGAGGG + Intronic
920752112 1:208688524-208688546 CTGCAGATATTTAAAGGAGGAGG + Intergenic
921712228 1:218384643-218384665 CTGTACATATTGAGAGAGGCTGG + Intronic
924070566 1:240274254-240274276 GAGCACATCATGAGAGGAGAGGG + Intronic
1062845871 10:704601-704623 ATTGGCATATTGAGAGGAGATGG + Intergenic
1063766342 10:9145464-9145486 CTTCACACATTGAGAGATGAAGG - Intergenic
1064660197 10:17600279-17600301 CTGCTCAGGGTGAGAGGAGAGGG - Intronic
1064788584 10:18928839-18928861 CTGGATATATTGAGTAGAGAGGG + Intergenic
1065176555 10:23081925-23081947 CTGAACATATTTACAGGGGATGG - Intergenic
1068793535 10:61052891-61052913 CTGCCCTTAGTGTGAGGAGATGG - Intergenic
1071041179 10:81309640-81309662 CTGGGCCTATTGAGAGGTGACGG - Intergenic
1073165126 10:101440756-101440778 TTTCACATTTTCAGAGGAGAGGG - Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076805291 10:132853821-132853843 CTACAGATATTGAAAGGATAAGG - Intronic
1079849411 11:25512074-25512096 CTTCACATAGTGGCAGGAGAGGG - Intergenic
1080573983 11:33581309-33581331 CAGCAAATGTTGAAAGGAGAAGG - Intronic
1080594953 11:33764506-33764528 CTGGATATAATGTGAGGAGAAGG + Intronic
1081766426 11:45614310-45614332 CTTCACACATTGAGAGTAGTGGG - Intergenic
1083782797 11:64926697-64926719 CGGCACATCTGGGGAGGAGAGGG - Exonic
1083882489 11:65555415-65555437 CTGCATATATAGAGAGGGGGGGG - Intronic
1084862840 11:72032412-72032434 TTGCAGGTATTGATAGGAGATGG - Intronic
1086877661 11:92116253-92116275 CTGCACCTATTGAGATGATATGG - Intergenic
1088463431 11:110107774-110107796 CAGCACTTATTGAGAGGCCAAGG - Intronic
1088724747 11:112624021-112624043 CTGCACATCTTCAGAGCAGGTGG + Intergenic
1088745688 11:112802091-112802113 CTGAAAATGTAGAGAGGAGATGG - Intergenic
1092081327 12:5718777-5718799 AAGCACATAGAGAGAGGAGAGGG - Intronic
1092206225 12:6615747-6615769 CTCCACATGGTGAGAGGAGCTGG - Intergenic
1092393397 12:8102082-8102104 CTGCATCTATTGAGATGATATGG - Intergenic
1092698212 12:11198055-11198077 CTTCTCTTATTGAGAGAAGACGG - Intergenic
1095575670 12:43735558-43735580 CTTAAAATATGGAGAGGAGAAGG - Intronic
1097960387 12:65526698-65526720 CTCCACCTTTTGTGAGGAGAGGG - Intergenic
1099575770 12:84379326-84379348 CTTGACACATTGAGAGGGGATGG - Intergenic
1100981681 12:100167117-100167139 GTGCACATTGAGAGAGGAGAAGG - Intergenic
1101817112 12:108153704-108153726 CTGCACAGAGGGAGAGGTGATGG + Intronic
1102307322 12:111814950-111814972 CTGCAGAGATTGTGAGGAAATGG - Intergenic
1102811873 12:115831453-115831475 CTGAACATTTTTAGAGGACATGG + Intergenic
1103493602 12:121343631-121343653 CAGCACATATTGAGAGCAAGAGG - Intronic
1108074792 13:46668609-46668631 CTGCACACATTGTCAGGAGAGGG + Intronic
1108870783 13:54983054-54983076 AAGCATATATTGAGAGGATAGGG - Intergenic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1109738652 13:66521326-66521348 CTGCACAATTTGAAAGGAAATGG + Intronic
1111662036 13:91223739-91223761 CTGCACATCTTGCGAGCAGAGGG - Intergenic
1112080399 13:95963300-95963322 CTGCATCTATTAAGAGGATATGG - Intronic
1112611661 13:100961045-100961067 CTCCACATATGGAGAGGTGAGGG + Intergenic
1117211373 14:53503893-53503915 ATGGACAAATGGAGAGGAGAAGG + Intergenic
1119552054 14:75522191-75522213 CTGCCCATGTTGACAGAAGACGG + Intergenic
1120861805 14:89261487-89261509 CTGAATATATTAAGAAGAGAAGG + Intronic
1121781134 14:96623353-96623375 CTGAGCATGTTGAGAGGAGATGG + Intergenic
1121782514 14:96631064-96631086 CTTCACAGTTTGAGCGGAGAAGG + Intergenic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1127414453 15:58744225-58744247 CTATACATATTGAAAGGTGAGGG + Intronic
1127417805 15:58774047-58774069 CTGCAGAAATTCAGAGGAAAGGG + Intronic
1128270419 15:66304503-66304525 CTACGCATCTTGAGAGGTGAGGG + Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1131705294 15:94988344-94988366 CTGCAAATATTCAAAGGATAAGG + Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1133673714 16:8049179-8049201 CAGAACATATTGTTAGGAGAAGG + Intergenic
1135425393 16:22330837-22330859 CTGCAAACATTAAGAGGAGATGG - Intronic
1135425746 16:22334305-22334327 CTGCAAACATTAAAAGGAGATGG - Exonic
1137289695 16:47043513-47043535 CTGCACATCTCGTGAGCAGAGGG + Intergenic
1137567964 16:49545404-49545426 TTGCACATGTTGAGATGTGATGG - Intronic
1139258835 16:65572511-65572533 CAGGACATACTGATAGGAGATGG - Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1141404780 16:83782811-83782833 CTGCCCACATTGAGAGCAGGTGG + Intronic
1142266739 16:89067385-89067407 CTGCATGTAGTGGGAGGAGAAGG - Intergenic
1145741999 17:27282591-27282613 CTCCACATATTGGGAGGCCAAGG + Intergenic
1148031506 17:44624551-44624573 CTGCACAGTTTGACAGGACATGG + Intergenic
1149437098 17:56642436-56642458 TTGAAAATATTTAGAGGAGACGG - Intergenic
1151617584 17:75224425-75224447 CTGGACATTTTGTGAGAAGATGG + Intronic
1155249342 18:23940205-23940227 CTGCAGATACTGTGAGGGGAGGG + Intronic
1156498746 18:37543531-37543553 CTGCACATCATGTGAGGAGCAGG - Intronic
1156568837 18:38228155-38228177 CTCCCCATTTTGAGAGGGGAAGG + Intergenic
1156635504 18:39023597-39023619 TTGCACAGATGGAGAGGAGAAGG + Intergenic
1156840378 18:41603967-41603989 CTACACCAATTGAGAGGAAAGGG + Intergenic
1157139587 18:45092482-45092504 CTCCACATATTAAGGGTAGAAGG + Intergenic
1158666511 18:59437686-59437708 TTGCACTTTTTAAGAGGAGATGG + Intronic
1159556439 18:69950688-69950710 CTGGATACATTGAGGGGAGATGG + Intronic
1163153483 19:15428106-15428128 CTACAGAGGTTGAGAGGAGACGG + Intronic
1166948426 19:46411470-46411492 CTGCACATAATCAGAGGGCAGGG - Exonic
924997034 2:371240-371262 CTGTATTTATTGAGACGAGAGGG + Intergenic
925937968 2:8785751-8785773 CTGCACAAATTGAAAAGTGAAGG - Exonic
926314415 2:11698752-11698774 TTGCACATTTTGTGAGCAGAAGG + Intronic
927089398 2:19699086-19699108 CTGAACATATTGATACCAGAAGG - Intergenic
927282307 2:21319934-21319956 CTGCACATTTTGAGAAGAAATGG - Intergenic
927947679 2:27146946-27146968 GTGAACATATAGAAAGGAGATGG - Intergenic
928328228 2:30336931-30336953 TTGCAGCTATTGAGAGGACAGGG + Intergenic
928651202 2:33405466-33405488 CTGCAAATGGTGAGAGGAAAAGG - Intergenic
930190856 2:48457924-48457946 CTGCAAATATTGTAAGGAGCAGG - Intronic
933288454 2:80409508-80409530 CAGCAGAAAGTGAGAGGAGATGG + Intronic
933306467 2:80606081-80606103 CTGCAGATGTTGAGAAGAGTTGG + Intronic
935155055 2:100477471-100477493 CTGCACATATTAAGAAAGGATGG - Intronic
935206737 2:100902835-100902857 CTGCACCCAGTGTGAGGAGAGGG - Intronic
942352255 2:175065168-175065190 CTCCACTTAAGGAGAGGAGAGGG + Intergenic
948217214 2:236240620-236240642 CTGCACATCTTGAGTGGGCAGGG + Intronic
1169492971 20:6086745-6086767 CTTCACATTGTGACAGGAGAGGG - Intronic
1169863267 20:10173489-10173511 CTGCAAATATGGGGATGAGATGG - Intergenic
1170666070 20:18387216-18387238 CTCCCCATATTGAGAGCAGAGGG + Intronic
1170757928 20:19221226-19221248 CTGCACATATTGAGAGGAGATGG - Intronic
1171006787 20:21474026-21474048 CTGTCCATATTGAGAAAAGATGG - Intergenic
1171950734 20:31419172-31419194 CTGAACATATTCAAAGGATATGG + Intergenic
1173979511 20:47212313-47212335 CTCCTCATATGGAGAGGACACGG + Intronic
1177744902 21:25200060-25200082 CTGCACACACAAAGAGGAGAGGG - Intergenic
1178957587 21:37037341-37037363 CTGCACATCTTCAGAAGACAGGG - Intergenic
1179604790 21:42507708-42507730 CCTCACATAGTGAGAGGGGAAGG + Intronic
1185240093 22:49737713-49737735 CCGCATATACAGAGAGGAGAGGG + Intergenic
1185240099 22:49737744-49737766 CCGCATATACAGAGAGGAGAGGG + Intergenic
1185240117 22:49737837-49737859 CCGCATATACAGAGAGGAGAGGG + Intergenic
950867884 3:16203933-16203955 CTCCTCACATGGAGAGGAGAGGG + Intronic
954458995 3:50615820-50615842 GTGCAGATGTTGAGTGGAGATGG - Intronic
965823666 3:172709692-172709714 CTACACATAATGAGTGGACAGGG + Intronic
967483294 3:189999841-189999863 CTTCACAGCTTGAGAGGAAATGG - Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
970168038 4:13260798-13260820 CTGTACATTTTGAAAGGAGAAGG - Intergenic
970667523 4:18354465-18354487 CTCCACTTAAGGAGAGGAGAGGG - Intergenic
971972666 4:33640200-33640222 CTGCACATAATGAGAATTGAGGG - Intergenic
972769162 4:42180040-42180062 CTGCCCAGATTGAAAGGAGATGG - Intergenic
974258762 4:59496978-59497000 CAGCACATATTGACTGGAAAGGG - Intergenic
977586391 4:98779762-98779784 CTGCACAAATGGAGGGGAGGAGG - Intergenic
979362854 4:119784630-119784652 CTTCACATGGTGACAGGAGAGGG + Intergenic
979434009 4:120667666-120667688 CTGCACATATGGAGACCACAGGG - Intergenic
984561180 4:181272664-181272686 ATGCAGCTATTGAGAGGAGGTGG + Intergenic
984838871 4:184049804-184049826 GTGCAAATATTGAGATGTGATGG - Intergenic
984862676 4:184254265-184254287 CTTCCCATATTGAGAGGAGCTGG + Intergenic
986008356 5:3687210-3687232 ATGCACATAGAGAGAGGAGTGGG + Intergenic
987658531 5:20840852-20840874 CTGCACATTTGAAGAGGAAATGG - Intergenic
989502484 5:42184589-42184611 CTGAACATTTTGAGAGGAGAGGG - Intergenic
990578697 5:57148392-57148414 CTTCACATGGTCAGAGGAGAAGG - Intergenic
990827877 5:59922450-59922472 CTCCACCTAAGGAGAGGAGAGGG + Intronic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
993625154 5:90215082-90215104 CTGCAGACAGTGAGAGGAAAGGG + Intergenic
994314780 5:98320139-98320161 CTGCAATTATTAAGATGAGAGGG - Intergenic
995972309 5:117987019-117987041 CTGCAAATATTAAGAGGATATGG + Intergenic
996754523 5:126921847-126921869 CTGCACACAGTGGGAGGAGCGGG + Intronic
997748310 5:136319325-136319347 CAGCACATAAGCAGAGGAGATGG - Intronic
999687309 5:154114792-154114814 AGGAACATATTGAGGGGAGATGG - Intronic
1002661698 5:180795576-180795598 CTGCACACATAGAGAGCAAATGG + Intronic
1003178402 6:3771447-3771469 CTGCCCCTAGTGAGAGGTGACGG + Intergenic
1006657049 6:35604570-35604592 CTGCCCATATTGAGATCTGATGG - Intronic
1007187019 6:39980551-39980573 CTGCTGATAGTGAGGGGAGACGG + Intergenic
1009617608 6:66030849-66030871 CAGAACAAATTGAGAGGTGATGG - Intergenic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1012291276 6:97458567-97458589 CAGCAAATAAAGAGAGGAGAGGG - Intergenic
1014000374 6:116358728-116358750 ATGCTCATATTGGCAGGAGAAGG - Intronic
1014575769 6:123070250-123070272 CGACACATAGTGAGATGAGAAGG - Exonic
1015579561 6:134708774-134708796 CTGCACATACTCAGTGAAGAAGG + Intergenic
1015615098 6:135066308-135066330 ATACACATATTGAGGTGAGAAGG - Intronic
1017759128 6:157554609-157554631 CTGCACAGATTTAGAGGACAAGG + Intronic
1019924185 7:4181549-4181571 ATGCACATGTTGGGAGGGGAGGG - Intronic
1021133252 7:16936234-16936256 CTGAACACAATGACAGGAGAGGG - Intergenic
1021148358 7:17117815-17117837 CTCCACATCTTGAAAGGAGAAGG + Intergenic
1021167394 7:17358327-17358349 CTGCACATCCTGTGAGCAGAGGG - Intergenic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1024100962 7:46032507-46032529 CTGCAAATATAGAAAGGAAACGG - Intergenic
1026036161 7:66832051-66832073 TTCCACATCTTCAGAGGAGAGGG - Intergenic
1026520466 7:71113360-71113382 CTGCACCTATTCACAGGTGACGG + Intergenic
1027214439 7:76174692-76174714 TTCCACATCTTCAGAGGAGAGGG + Intergenic
1028181432 7:87729823-87729845 CTCCACCTAAGGAGAGGAGAGGG + Intronic
1028234023 7:88338517-88338539 CTCCACATACTGGAAGGAGAGGG + Intergenic
1033704887 7:143876800-143876822 CTGCAGAATTTAAGAGGAGAGGG - Intronic
1034301933 7:150023975-150023997 GAGCACAGATTTAGAGGAGAAGG + Intergenic
1034448967 7:151127355-151127377 CTGCCCATACTTAGAGGAGGGGG - Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036110423 8:5894062-5894084 CTGCAGATATTGACAAAAGAAGG + Intergenic
1036293571 8:7517240-7517262 CTGCACATCTTGAGTGGAGCAGG - Intergenic
1036328990 8:7803755-7803777 CTGCACATCTTGAGTGGAGCAGG + Intergenic
1036684818 8:10902681-10902703 CTCCAAATAGTGAAAGGAGAAGG + Intronic
1037622272 8:20575010-20575032 CTGCAGACATTCAGAGGAGGAGG + Intergenic
1038633453 8:29266772-29266794 CTGAAAATATTTAGAGGAAAAGG + Intergenic
1040922388 8:52636756-52636778 CTGCGCATATGGTGAGGAAAGGG + Intronic
1042786000 8:72547584-72547606 CTGCACATATGGTGGAGAGAAGG + Intronic
1046735506 8:117772299-117772321 AGGCACGTATTGAGAGGAAAAGG - Intergenic
1048096234 8:131298209-131298231 CTCCAAATGTTTAGAGGAGAAGG + Intergenic
1048166226 8:132063813-132063835 TTGCACAGATTCACAGGAGAGGG + Intronic
1048206927 8:132422917-132422939 CAGCACACATAGAGAGGAGCAGG + Intronic
1049606872 8:143533649-143533671 CTGCATGGAGTGAGAGGAGAGGG - Intronic
1050807517 9:9699699-9699721 TTGCACTTATTGAAAGAAGAGGG + Intronic
1051117118 9:13708517-13708539 CTGCAAATATTTAGGGGACAAGG + Intergenic
1051669548 9:19495781-19495803 CTGCACATACTGAAAAGAAATGG - Intergenic
1052476414 9:28966145-28966167 CAGCACAGTTTGAGAGGAGGTGG - Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1056847379 9:90052492-90052514 TTGCACTTATTGAGAGGAATAGG + Intergenic
1057087363 9:92224008-92224030 CTCCAAATATTGAGTGGAAATGG + Intronic
1057137335 9:92702014-92702036 CTGCATTTATTGATAGGATAGGG + Intergenic
1057158213 9:92863748-92863770 TTGCACATATTGAGATTACAGGG + Intronic
1061071645 9:128314435-128314457 CTGCACAGATTCAGAGGAGGGGG - Intronic
1061931672 9:133836117-133836139 CTGCATATCATGGGAGGAGATGG - Intronic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1189077558 X:37933072-37933094 CTGCACAGATTTAAAGGAGGTGG + Intronic
1194133319 X:90108489-90108511 ATGCACATTTTCAAAGGAGAAGG - Intergenic
1195065660 X:101236091-101236113 ATGCACAGGCTGAGAGGAGAAGG - Intronic
1195364754 X:104115155-104115177 CTGCTCATATTGTGGGGAGGAGG + Exonic
1195411066 X:104567937-104567959 CGGCACAGATGGAGAGGGGATGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196520732 X:116667972-116667994 CTGCACATATTGAGAGAGACGGG - Intergenic
1196574630 X:117303641-117303663 CTGCCCATATTATGAGCAGATGG + Intergenic
1198257255 X:134934474-134934496 ATGCAGATATTGGGAGGGGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1201946070 Y:19511703-19511725 CTACACAGATAGAGAGTAGAAGG + Intergenic
1202023296 Y:20491422-20491444 CTCCACTTATGGAGAGGCGAGGG + Intergenic