ID: 1170758371

View in Genome Browser
Species Human (GRCh38)
Location 20:19225428-19225450
Sequence CCACAATGCTTGGAAAATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170758371 Original CRISPR CCACAATGCTTGGAAAATAC CGG (reversed) Intronic
901866442 1:12109869-12109891 CCACAGGGCTTAGAAAACACAGG + Intronic
902220530 1:14961599-14961621 CCACAGTGCTTGGAGAACTCAGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
905303321 1:37000132-37000154 CCCTAATGCCTGGAAAGTACTGG + Intronic
905585026 1:39110111-39110133 ACACAGTGATTGGAAAATATGGG + Intronic
907581250 1:55574650-55574672 CCACAATGCTTGGAGAGGAGGGG - Intergenic
907628712 1:56058253-56058275 ACACAATACTTGGCAAGTACTGG - Intergenic
908667619 1:66510233-66510255 CCACATTGTTTGCAAAACACGGG + Intergenic
910269061 1:85373408-85373430 CCTCAATGCTTGGAGATAACAGG - Intronic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
913438278 1:118870226-118870248 CCACAATGCTGGGAAAACTGAGG + Intergenic
917223585 1:172758162-172758184 TCACAATGCTAGGAACATAGTGG - Intergenic
918897763 1:190369038-190369060 CCACAATACTTGGGGATTACAGG + Intronic
920941344 1:210485824-210485846 CCACAATACATGGAAATTATGGG + Intronic
921393902 1:214648136-214648158 CCAAAATTCTTAGAAAATACAGG - Intronic
1063153071 10:3354524-3354546 CCACAATGCATGGGAATTATAGG - Intergenic
1064532171 10:16321783-16321805 CCACAATGCATGGGAATTATAGG - Intergenic
1065220890 10:23495033-23495055 CCAAAATGCCTGGAAGATGCTGG + Intergenic
1065257979 10:23893649-23893671 ACACACTGCTTTGAAAAGACAGG + Intronic
1065831818 10:29621440-29621462 CCACCATGCTTGGGAAACAGGGG + Intronic
1066996818 10:42571517-42571539 CCACCATGATTGGAAGATTCTGG + Intergenic
1067780637 10:49203398-49203420 ACACAAGGTTTGGAACATACAGG - Intergenic
1070497937 10:77041559-77041581 CCAAAATGCTCCCAAAATACAGG + Intronic
1070571827 10:77645832-77645854 CCACAATACGTGGGAATTACGGG - Intergenic
1074931775 10:118133483-118133505 ACACAAAGCTTGTTAAATACAGG + Intergenic
1075911615 10:126129984-126130006 CCACATTGCTTCAAAAACACAGG - Intronic
1081025438 11:38007413-38007435 CTAATATGTTTGGAAAATACTGG - Intergenic
1081120757 11:39262759-39262781 CCACAACACTTGGAAATTATAGG + Intergenic
1081221332 11:40466463-40466485 ATACTATGCTTGGAAAATAAAGG + Intronic
1081924453 11:46812906-46812928 CCAAAGTGCTGGGACAATACAGG + Intronic
1083121736 11:60520109-60520131 CCACAATACTTGGGAATTATGGG - Intronic
1084430397 11:69107620-69107642 CCCCACTGCTTAGAAAATCCTGG - Intergenic
1088524819 11:110741188-110741210 CCACAATACTTGGGAATTATGGG - Intergenic
1092225105 12:6743377-6743399 CCACAATACGTGGGAATTACGGG - Intergenic
1093208446 12:16279497-16279519 CCACAATACTTGGGAATTATGGG + Intergenic
1094668824 12:32548813-32548835 CCTCAAGGCTGGGAACATACGGG + Intronic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1096612997 12:52815344-52815366 CCACAATGTGTGGGAAATATGGG - Intergenic
1099500493 12:83407901-83407923 TTAGAATGCTTGGAATATACAGG + Intergenic
1099627900 12:85099293-85099315 GCATAGTCCTTGGAAAATACAGG + Intronic
1101663443 12:106787780-106787802 CCACAGTGCGTGGGAATTACGGG + Intronic
1103118050 12:118354604-118354626 CCACAATGCTTGGGAATTGTGGG - Intronic
1103973012 12:124683863-124683885 CCACAAAGTTTGGGAAGTACGGG - Intergenic
1104055724 12:125228526-125228548 CCAGATTGATTGGAAAACACAGG + Intronic
1104128865 12:125873609-125873631 CCACAACACTTGGGAATTACGGG - Intergenic
1109818481 13:67619596-67619618 CCACAAAGCTTTGACAAGACTGG - Intergenic
1109913539 13:68949006-68949028 CCACAAGGATTAGAAAATATTGG - Intergenic
1110328305 13:74242528-74242550 CCACAATACATGGGAATTACGGG + Intergenic
1111208808 13:85049894-85049916 CCACAATGCGTGGGAATTATGGG + Intergenic
1111891504 13:94088426-94088448 CCAAAATGCTAGGATATTACGGG - Intronic
1112979040 13:105358654-105358676 CCACAACACTTGGGAATTACGGG - Intergenic
1116737300 14:48708346-48708368 GTACAATGATAGGAAAATACTGG + Intergenic
1116761948 14:49025937-49025959 CCACAACACGTGGAAATTACGGG - Intergenic
1117501177 14:56353090-56353112 CCACAAGGCTGGGAAATCACAGG - Intergenic
1117767647 14:59099691-59099713 CCCCAATACCTGGACAATACTGG - Intergenic
1118802097 14:69200184-69200206 AAATAATGCTTGGAATATACTGG - Intronic
1120013162 14:79440403-79440425 ACAGCATGCCTGGAAAATACTGG + Intronic
1120987250 14:90345291-90345313 CCAGAATGCATGGGAAATCCTGG + Intergenic
1127065946 15:55238566-55238588 GCACAATGGTTGGCATATACTGG + Intronic
1127159109 15:56162169-56162191 CCACAATGCTTTCAAAAAACTGG + Intronic
1127669012 15:61176570-61176592 CCAAAATGCTTGGGGATTACAGG + Intronic
1127816190 15:62611246-62611268 CCCCAATGATTGAAAAAAACTGG + Intronic
1129928407 15:79386108-79386130 CCCCAGCCCTTGGAAAATACAGG - Intronic
1133565051 16:6985505-6985527 ACACTATGTGTGGAAAATACTGG + Intronic
1133934757 16:10259710-10259732 CCATAGAGCTTGGAAAACACTGG - Intergenic
1134764114 16:16741400-16741422 CCATGATGCTTGGCAAACACAGG - Intergenic
1134981943 16:18617809-18617831 CCATGATGCTTGGCAAACACAGG + Intergenic
1135644780 16:24152361-24152383 CCACAACACGTGGAAATTACGGG + Intronic
1137011874 16:35329514-35329536 CCACAAAACTTGGGAATTACAGG - Intergenic
1138744043 16:59342757-59342779 CAACAATGTTGGGAAAACACAGG + Intergenic
1140495451 16:75383086-75383108 CCTCAATGATGGGAAAATATTGG + Intronic
1141814216 16:86398552-86398574 CCATAATACTTGCAAAAAACTGG - Intergenic
1142076540 16:88121147-88121169 CCACAATGCATGGTACATAGCGG - Intergenic
1142300285 16:89253829-89253851 CCAGAATGCTAGGAATTTACAGG - Intergenic
1143812774 17:9485871-9485893 CCACCATGCTCGGACAATCCGGG + Intronic
1144306674 17:13974800-13974822 CCACAATGCTTGACATATAAAGG - Intergenic
1145976002 17:28984794-28984816 CCACAATCCTGGGAAACTAGGGG - Intronic
1146629879 17:34462280-34462302 CCACACAGTTTGGAAAATATTGG - Intergenic
1146662731 17:34675339-34675361 CCACAATGCTGGGTAGATCCTGG - Intergenic
1148602883 17:48907757-48907779 CCACAAATCTTGGAATATACAGG - Intergenic
1149106585 17:52974807-52974829 TCACAATCCTTGGGAGATACTGG + Intergenic
1150341863 17:64374903-64374925 CAAAAAAGCTTGAAAAATACTGG + Intronic
1150437645 17:65166490-65166512 TCCCAGTGCTTGGAATATACTGG + Intronic
1151291138 17:73150944-73150966 CCACAACACGTGGAAATTACGGG + Intergenic
1154042051 18:10865658-10865680 CCATATTGCTTTGAAAATATTGG - Intronic
1159197855 18:65141719-65141741 CCACAGAGCTTTTAAAATACTGG + Intergenic
1161788879 19:6346639-6346661 CCAAAATGCTAGGATAATCCTGG + Intergenic
1161804734 19:6436306-6436328 CCACAAAGCTTGGACTATCCAGG + Intronic
1165615717 19:37198475-37198497 CCAAAGTGCTTGTAAAACACTGG - Intronic
1165818134 19:38655985-38656007 CAACAATGGATCGAAAATACTGG - Intronic
1165826871 19:38710535-38710557 CCTCAATGCCTGGAAAAGCCTGG - Intronic
1167614059 19:50521818-50521840 CCAAAGTGCTGGGAAATTACAGG + Intronic
1168623658 19:57899058-57899080 CAACAATGATTCCAAAATACTGG + Intronic
925556244 2:5134210-5134232 GCTCAATGCGTGGCAAATACAGG - Intergenic
926665593 2:15518966-15518988 CCACAACACGTGGAAATTACGGG + Intronic
927383628 2:22507547-22507569 CCTCCAGGGTTGGAAAATACTGG - Intergenic
927855555 2:26525412-26525434 GCACATTGGCTGGAAAATACTGG + Intronic
928707330 2:33964373-33964395 TCCCAATGCTTGGGAACTACTGG + Intergenic
929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG + Intergenic
930226606 2:48800540-48800562 CAACAAAGCTGGGAAAAGACTGG + Intergenic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
931061264 2:58532252-58532274 CCAGAATGCATGAAAAAAACTGG - Intergenic
931650878 2:64467682-64467704 ACACACTGCTTGGGAAATGCAGG - Intergenic
932134742 2:69218474-69218496 TCAAACTGCTTGGAAAATGCAGG + Intronic
935486311 2:103659051-103659073 CCAAAGTGCTGGGATAATACAGG + Intergenic
937012890 2:118577453-118577475 CCACGATGACTGGAACATACGGG + Intergenic
938183287 2:129204698-129204720 CCACAATGGTTGAACTATACTGG + Intergenic
939732454 2:145801410-145801432 CCACAATGATTGGAGAACAGTGG + Intergenic
940064270 2:149609212-149609234 CCACAAAGCTTCCAGAATACTGG - Intergenic
943275585 2:185863506-185863528 CAAAGATGCTTGGAAATTACAGG - Intergenic
943467043 2:188240702-188240724 TCACAATGATTGGAAAAAAATGG - Intergenic
945398900 2:209355429-209355451 CCACAATACTTGGGAATTATGGG - Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
948244300 2:236465282-236465304 CCACATGGCTTGGAATATAATGG - Intronic
948453627 2:238093811-238093833 GCACAATTCTTGCAAAATAAAGG - Intronic
1169150896 20:3288555-3288577 GAGCAATGCTTGGGAAATACAGG - Intronic
1170528977 20:17270378-17270400 CCATAAAGCTTTGAAATTACTGG - Intronic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1172397035 20:34615308-34615330 AAACAATGCTTGGAACATAGTGG - Intronic
1172821634 20:37740658-37740680 CCAAAGTGCTTAGAAAATTCTGG + Intronic
1172971573 20:38876860-38876882 TTAAAATGCTTGGGAAATACTGG + Intronic
1173176724 20:40770665-40770687 CAACAGTGGTGGGAAAATACTGG - Intergenic
1175425730 20:58864792-58864814 CCAAAATGCTTCTAAAATCCTGG - Intronic
1176693561 21:9947300-9947322 CCACAACACATGGAAATTACAGG + Intergenic
1178006451 21:28226057-28226079 CCACAACACGTGGAAATTACGGG + Intergenic
1178346209 21:31830531-31830553 CTAAAATGATTGAAAAATACTGG + Intergenic
1179267893 21:39821252-39821274 CAAAAATGCTAGGAAAATTCTGG - Intergenic
1182916487 22:34037504-34037526 GCACACTGGTTGGAAAATAAGGG + Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184201001 22:42969561-42969583 CCATATTGCTTGGATAATGCCGG - Intronic
949113886 3:296351-296373 CCAAAATTCTGTGAAAATACAGG + Intronic
950473160 3:13198980-13199002 ACAGAGAGCTTGGAAAATACAGG - Intergenic
952105695 3:30066732-30066754 CCACAATGCATGGGAATTATGGG + Intergenic
953472565 3:43179560-43179582 CCAAAATATTTGGGAAATACAGG + Intergenic
953572198 3:44079914-44079936 CCACAAGGCTTGAAAAGCACTGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
956938469 3:74131110-74131132 CCACAACACTTGGGAATTACGGG + Intergenic
957525321 3:81372125-81372147 CTAGAATGGGTGGAAAATACAGG + Intergenic
957935461 3:86936148-86936170 CCACAATTCTTGGTAATTATAGG + Intergenic
964252323 3:154732986-154733008 CCACAATGCATGGGAATTATGGG - Intergenic
964489849 3:157224182-157224204 CCAGAAGGATTGGAAAATATTGG + Intergenic
965444118 3:168753247-168753269 CCCCAGTGCTTGGAACATAATGG - Intergenic
965992272 3:174833500-174833522 GCACAAATCTTGGAAAATAAAGG + Intronic
966274207 3:178145184-178145206 AGACAATAATTGGAAAATACAGG + Intergenic
967241793 3:187446639-187446661 CCACAATGCTTAGCAACTAGTGG + Intergenic
969995494 4:11308129-11308151 CCACAATGCATGGGAATTATGGG - Intergenic
970762051 4:19502028-19502050 CCACAATGCATGGAGATTATGGG - Intergenic
970802160 4:19985971-19985993 CCACAATGCGTGGGAATTATGGG - Intergenic
971503334 4:27340319-27340341 CCACAATACCTGGGAATTACGGG + Intergenic
971917218 4:32887542-32887564 TCTTAATGCTTAGAAAATACAGG + Intergenic
976647991 4:87405488-87405510 TAACAATGATTGCAAAATACTGG - Intergenic
977733952 4:100389388-100389410 CCACAATTCTTAGATAATAGAGG + Intergenic
978172174 4:105686210-105686232 CCACTATGCCTGGGAATTACAGG + Intronic
979259748 4:118635419-118635441 CCACAATTCATGGTACATACAGG + Intergenic
980001102 4:127488991-127489013 CCAAAATGCCTGGAAAAATCAGG + Intergenic
980366180 4:131807538-131807560 CCACAATACATGGAAATTACGGG + Intergenic
980718883 4:136666810-136666832 ACACAATTCTTAGAAAATAGGGG + Intergenic
980910040 4:138986061-138986083 CCACAATGCTTGGCTAATCCTGG - Intergenic
983430853 4:167648826-167648848 CCACAATGCATGGGAATTATGGG + Intergenic
984021503 4:174489175-174489197 AGACAATGAATGGAAAATACAGG - Intergenic
984410083 4:179386577-179386599 CCACAACACATGGAAATTACGGG + Intergenic
986243766 5:5985792-5985814 ACAGAATGCTAAGAAAATACTGG + Intergenic
987269081 5:16286708-16286730 CCTCAATGCTTGGAACATAATGG - Intergenic
987493922 5:18617710-18617732 CCACAATGCATGGGAATTATGGG + Intergenic
989996960 5:50846854-50846876 CAAAAATGCTTAGAAAATTCAGG - Intergenic
990303967 5:54476974-54476996 CTATAATCCTTGGAAAACACAGG + Intergenic
992352935 5:75949515-75949537 CCACAACATGTGGAAAATACAGG - Intergenic
993277537 5:85879807-85879829 CCAAAATCCTTAAAAAATACTGG - Intergenic
994152449 5:96463444-96463466 CCACATTGCAGGGAAAACACAGG + Intergenic
994312106 5:98285407-98285429 CAATAAATCTTGGAAAATACTGG + Intergenic
994587616 5:101729966-101729988 GCAAAATGTTTGTAAAATACAGG + Intergenic
995770104 5:115660090-115660112 CCATAATGGTTGGATACTACAGG + Intergenic
996247650 5:121283719-121283741 CCACAATGCATGGAAATTATGGG - Intergenic
996525920 5:124479346-124479368 CCACAATGTTTGGCTAATATTGG - Intergenic
997120918 5:131171951-131171973 CCACTATGCTTAGACAATATAGG - Intronic
997594401 5:135096395-135096417 GCACAATGCTTGGAAAACAATGG - Intronic
1000357710 5:160416872-160416894 CCACAACACTTGGGAATTACAGG - Intronic
1000494036 5:161955824-161955846 ACAAAATGCCTAGAAAATACTGG - Intergenic
1002293820 5:178217479-178217501 CCAAAGTGCTAGGAAATTACAGG + Intronic
1002624600 5:180516480-180516502 CCAAAGTGCTGGGAAAATTCAGG + Intronic
1004348691 6:14871992-14872014 CCACAATACTTTGAAAAATCTGG + Intergenic
1004592920 6:17070769-17070791 CCACAACACTTGGGAATTACGGG - Intergenic
1004982438 6:21040847-21040869 GCACAATGCTTGAAAAAGAGAGG - Intronic
1008790938 6:55232710-55232732 TCACAAAGCTTGGAACATAATGG - Intronic
1009056038 6:58336384-58336406 ACACAATTCTTGGAAAATGATGG + Intergenic
1009235140 6:61114214-61114236 ACACAATTCTTGGAAAATGATGG - Intergenic
1009451487 6:63805850-63805872 CCACCATGCTTGTAAATTTCCGG + Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1012278068 6:97297315-97297337 CCACAACGCGTGGAAATTATGGG + Intergenic
1012310622 6:97719950-97719972 AAACAATGCCTGGAATATACAGG + Intergenic
1012370224 6:98496265-98496287 GCAGTAAGCTTGGAAAATACAGG - Intergenic
1014449215 6:121564374-121564396 CCACAATGCATGGGAATTATGGG - Intergenic
1014482335 6:121954063-121954085 CCACAATGCATGGGAATTATGGG + Intergenic
1015633690 6:135255405-135255427 CCGCAATGCGTGGAAATTACGGG - Intergenic
1017774759 6:157672316-157672338 CCACATTGTTTTAAAAATACAGG - Intronic
1017861945 6:158406822-158406844 CAAAAAAGTTTGGAAAATACAGG + Intronic
1018399659 6:163410022-163410044 CAAAAATGCTGTGAAAATACCGG - Intergenic
1019457900 7:1140501-1140523 CCACAATGCATGGGAATTATGGG - Intergenic
1019882742 7:3877230-3877252 CTCCAATGCATGGAAAAAACAGG - Intronic
1020908904 7:14103369-14103391 CAACAAGGCTTTGAAAATAAAGG + Intergenic
1022952393 7:35351232-35351254 GCACAATGTTTGGAAACGACAGG - Intergenic
1023004940 7:35854249-35854271 AGTCAATGCTTGTAAAATACTGG + Intronic
1023205613 7:37746151-37746173 GCACAATGCTACGAAAATAATGG - Intronic
1025218432 7:57081437-57081459 AGTCAATGCTTGTAAAATACTGG - Intergenic
1025629351 7:63255056-63255078 AGTCAATGCTTGTAAAATACTGG - Intergenic
1025652916 7:63489024-63489046 AGTCAATGCTTGTAAAATACTGG + Intergenic
1026079017 7:67200573-67200595 CCACAATACGTGGGAATTACGGG + Intronic
1029325908 7:99808599-99808621 CCACCATGCTTGGAAATTTGTGG + Intergenic
1029724318 7:102392301-102392323 CCAGGATGCTTGGAGAATAAAGG - Intronic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1030876756 7:114822811-114822833 TCACAATGATTGAAAATTACGGG + Intergenic
1031729190 7:125277010-125277032 CCACAATACATGGAAATTACAGG - Intergenic
1032161616 7:129515290-129515312 CCACAACACGTGGAAATTACAGG - Intergenic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1039175244 8:34796666-34796688 GCACAGTGTTTGGGAAATACAGG + Intergenic
1039702731 8:39978667-39978689 CCACAGTGTTTGGATAAGACAGG + Intronic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1042033463 8:64503385-64503407 CCACAATGCATGGGAATTACAGG + Intergenic
1042368211 8:67960472-67960494 CCTCCAGGCTTGGAAAAGACAGG - Intronic
1043530594 8:81145976-81145998 GCACAATGCCTAGAACATACTGG - Intergenic
1045401066 8:101818515-101818537 CCACATTGATTGAAAAATAGAGG - Intronic
1045980185 8:108176373-108176395 CCACAGTGCTTAGAATATAGTGG + Intergenic
1046008016 8:108509350-108509372 CTACAATGCTAGCAAAATAATGG - Intergenic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1046566364 8:115906088-115906110 CCAGAAGGCTTGGCAAATTCAGG + Intergenic
1046779452 8:118199942-118199964 CCACAATGCGTGGGAATTATGGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047772581 8:128042269-128042291 ACACAGTTCTTGGAAAATATGGG - Intergenic
1048116230 8:131526346-131526368 CCAGAGTGATTGGAAAATTCAGG + Intergenic
1048411059 8:134173447-134173469 CCACAATGATTGGAAAATAAGGG - Intergenic
1048716585 8:137277596-137277618 CAAAAATGCATAGAAAATACGGG - Intergenic
1048769576 8:137881562-137881584 CCACAATGCGTGGGAATTATGGG - Intergenic
1048844281 8:138591966-138591988 GTACAATGCTTTGAAAACACAGG - Intronic
1053630527 9:39933385-39933407 CCACAACACATGGAAATTACGGG + Intergenic
1053775245 9:41530124-41530146 CCACAACACATGGAAATTACGGG - Intergenic
1054213360 9:62317316-62317338 CCACAACACATGGAAATTACGGG - Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058274686 9:103024852-103024874 CCACAATGCATGGAAATTATGGG - Intergenic
1060762231 9:126264404-126264426 CCATAATGCTTTCAAAGTACGGG - Intergenic
1187213474 X:17252617-17252639 CCACAGAGTTTGGAAAATGCTGG + Intergenic
1188055927 X:25541298-25541320 CCACAATACTTGGGAATTATGGG + Intergenic
1188180343 X:27047621-27047643 ACACAATGCTGGGAAATCACTGG + Intergenic
1189845775 X:45135398-45135420 CCACAACACTTGGAAATTATGGG - Intergenic
1190248101 X:48704118-48704140 CCAGAATGAATGGAAAAGACAGG - Intronic
1191596056 X:62945218-62945240 CCACAATACATGGAAATTATGGG + Intergenic
1192235163 X:69290935-69290957 CCACCTTGCCTGGAAAATTCTGG - Intergenic
1194259915 X:91681803-91681825 CCACAACACGTGGAAAATACCGG + Intergenic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic
1196344649 X:114639464-114639486 CCTCCATGCTTGGAAAATGCAGG + Intronic
1199734863 X:150676377-150676399 GCACCCTGCTTGGAAATTACTGG - Intergenic
1200578613 Y:4920993-4921015 CCACAACATGTGGAAAATACCGG + Intergenic
1201017309 Y:9618877-9618899 CCAAAGTGCTTGGATTATACAGG - Intergenic
1202381254 Y:24277785-24277807 CCACAATTCATGGAATGTACAGG + Intergenic
1202489531 Y:25392341-25392363 CCACAATTCATGGAATGTACAGG - Intergenic