ID: 1170758791

View in Genome Browser
Species Human (GRCh38)
Location 20:19230748-19230770
Sequence TGTGACATGCGGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170758791_1170758794 -3 Left 1170758791 20:19230748-19230770 CCTTCCACAGTCCGCATGTCACA 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1170758794 20:19230768-19230790 ACAATCCCTTCTTGTGTGTTAGG 0: 1
1: 0
2: 2
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170758791 Original CRISPR TGTGACATGCGGACTGTGGA AGG (reversed) Intronic
900130257 1:1084347-1084369 TGTTACCTGAGGACTGTGGCGGG + Exonic
903363529 1:22792254-22792276 TGTGCTATGCTGACTGGGGAAGG + Intronic
906280517 1:44550184-44550206 TTTGCCAAGGGGACTGTGGAGGG - Intronic
907865932 1:58399093-58399115 TGTGACATGCTGACATTGCATGG - Intronic
908007726 1:59743935-59743957 TGTGACATGCTGCCTGGGCAGGG - Intronic
914910443 1:151781395-151781417 TGTGATATGGGGTCAGTGGAAGG + Intronic
915012615 1:152701771-152701793 TGTGACATGCTTACTTTGGCAGG - Intergenic
918294170 1:183139861-183139883 TGTGTCAGGGGGACTGTGGCTGG + Intronic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
920790290 1:209083561-209083583 TTTAACATGAGGCCTGTGGATGG + Intergenic
924928335 1:248705280-248705302 TTTGACATGGGAACTGTGAAAGG - Intergenic
1063022881 10:2147049-2147071 TGTGGCATGAGGACCATGGATGG - Intergenic
1063429242 10:5975411-5975433 TGGGAGATGAGGACTGTGCAGGG + Intronic
1066440723 10:35436128-35436150 TGTGACATGGGGACTGGGCAAGG + Intronic
1067667509 10:48290786-48290808 TGTGACATGTGCAGTGTGTATGG - Intergenic
1067987803 10:51170520-51170542 TGTGACATGTGGGATGGGGAAGG + Intronic
1072555532 10:96511799-96511821 TGTGACCTGGGGACTCTGGGAGG - Intronic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1076413636 10:130269546-130269568 TGTGACATGTGGGCTTTGGATGG + Intergenic
1076620397 10:131783652-131783674 TCTGACAGGTTGACTGTGGAGGG - Intergenic
1078421062 11:11213418-11213440 GATGACAAGGGGACTGTGGAGGG - Intergenic
1078846104 11:15119630-15119652 TGTGAAATGTGGCCTGTGGTTGG + Intronic
1079310528 11:19361572-19361594 AGTGACCTCAGGACTGTGGATGG - Intronic
1081307607 11:41532592-41532614 TGTGACATGTGGTCTGTGTGTGG + Intergenic
1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG + Intronic
1085024295 11:73227756-73227778 TGTGAAAGGCGGCCTGGGGAAGG + Intronic
1088312398 11:108473921-108473943 GGTGGCATGGAGACTGTGGAGGG - Exonic
1090978553 11:131696214-131696236 TGTCACGTGATGACTGTGGAAGG + Intronic
1092026916 12:5248381-5248403 TGTGCCAGGCTGGCTGTGGAGGG + Intergenic
1094490216 12:30956153-30956175 TGGGACATGTGGATGGTGGATGG + Intronic
1097728337 12:63099676-63099698 TGAGCAATGAGGACTGTGGAAGG - Intergenic
1098060188 12:66553699-66553721 TGAGACATGCGGGATGGGGAAGG - Intronic
1098300487 12:69048953-69048975 TGGGGCATGGGGTCTGTGGAGGG - Intergenic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1102574112 12:113845067-113845089 TGTGTCATCCGATCTGTGGAGGG + Intronic
1105014364 12:132777155-132777177 TGGGAAATGCTGCCTGTGGAAGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106240465 13:27908289-27908311 GGTGATAGACGGACTGTGGAAGG + Intergenic
1107944151 13:45402274-45402296 GGGGACAAGAGGACTGTGGAAGG - Exonic
1112186700 13:97134631-97134653 TGTGAGAAGCGGACTGTGGTGGG - Intergenic
1117810301 14:59538350-59538372 TATGACATGAGGAGTGGGGAGGG + Intronic
1119620906 14:76131277-76131299 TGGGGAATGCAGACTGTGGAAGG + Intergenic
1122984293 14:105205216-105205238 AGAGGCCTGCGGACTGTGGAAGG + Intergenic
1125481293 15:40082661-40082683 TGTGACTTTCGGACTTTGGCAGG + Intergenic
1128111927 15:65081927-65081949 TGACACATGCTGACTGTGGGTGG - Intergenic
1134101671 16:11456892-11456914 TGTGGCAGGCGGGCAGTGGAAGG - Exonic
1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG + Intronic
1139752569 16:69118655-69118677 TGTGGCATGTGAACTGTGGCAGG - Exonic
1147052117 17:37803067-37803089 TGTGACATGCACATTGAGGAGGG + Intergenic
1149009558 17:51841224-51841246 AATGACATGCGGACTGAAGATGG - Intronic
1150961346 17:69915612-69915634 TGTCACATGTGGGCTGGGGATGG + Intergenic
1151526934 17:74676574-74676596 TGAGGCATGCGGACTTTTGAGGG - Intronic
1156376354 18:36518726-36518748 TGTGGGATGTGGACTGGGGAGGG + Intronic
1156894428 18:42229266-42229288 TGTGAAGTGTGGATTGTGGATGG + Intergenic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158673786 18:59500559-59500581 GGTGCCATGGGGACTTTGGAGGG - Intronic
1160896828 19:1407083-1407105 TGTGAAATGCGGACAGGGGAAGG + Intergenic
1160982642 19:1823396-1823418 TGTGAAATGGGGACTGTTGAGGG - Intronic
1162449247 19:10744552-10744574 TGTGGAATGCAGACTGTGGGTGG + Intronic
1165196857 19:34110911-34110933 TCTGACCTGGGGACTCTGGATGG - Intergenic
1165299921 19:34962191-34962213 TGTGACATCTGGTGTGTGGACGG - Intronic
1165726606 19:38117223-38117245 AGTGCCATGTGGACTGTGGCTGG + Intronic
1165995729 19:39842570-39842592 TGTGAAAAGTGGACTGTAGAGGG - Intronic
1167395847 19:49228181-49228203 TGTGGCATGCCCATTGTGGATGG + Intergenic
1168483251 19:56739295-56739317 GGAGACATGCGGAGTGTGCAGGG + Intergenic
1202678066 1_KI270711v1_random:25573-25595 TTTGAAATGCGAACTGTGGCAGG - Intergenic
929069136 2:38011145-38011167 TGTGAATTGAGGACTGAGGATGG - Intronic
929843369 2:45495453-45495475 AGTGAGATGCTTACTGTGGAAGG - Intronic
930566646 2:53028882-53028904 TGTGAGATGGAGCCTGTGGAGGG + Intergenic
936505483 2:113102411-113102433 TTTGATATGTGGATTGTGGAGGG + Intergenic
939231150 2:139427751-139427773 AGTGACATGAGGAATGTTGAAGG + Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
939660134 2:144878998-144879020 GGACACATGGGGACTGTGGATGG + Intergenic
941870413 2:170378923-170378945 TGTAACAGGCAGACTGGGGAAGG - Intronic
946317440 2:218926444-218926466 TCTGAAATGTGGACTGTGCATGG + Intergenic
1169284638 20:4297737-4297759 TGTAAAATGCGGACAGCGGAGGG + Intergenic
1170368744 20:15625299-15625321 CAGGACATGTGGACTGTGGAAGG + Intronic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1171369253 20:24650404-24650426 CGTGCCATGTGGACTGAGGATGG - Intronic
1172120830 20:32597761-32597783 TGTGCCATGAGGAGTTTGGATGG + Intronic
1173993468 20:47320337-47320359 TGTGACAAGGTGACTGTGGAGGG - Intronic
1175109484 20:56636820-56636842 TGAGCCATCGGGACTGTGGAGGG - Intronic
1177984434 21:27955943-27955965 TGTGACATGCTGTGTGTGGAAGG - Intergenic
1178028334 21:28493931-28493953 TCTGATATGTGAACTGTGGATGG + Intergenic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
949395116 3:3606679-3606701 GGTGAAATGGGGAGTGTGGAAGG - Intergenic
950797534 3:15522162-15522184 TGTCACAGGCTGACAGTGGAGGG - Intergenic
952285045 3:31960299-31960321 AGTGACAAGCGGAGTGTGGCTGG - Intronic
955202886 3:56867193-56867215 TGTTACATGCTGTCTTTGGAAGG - Intronic
956250031 3:67226212-67226234 TTTGGCATGCAGCCTGTGGAAGG - Intergenic
968964780 4:3764365-3764387 TGTGACCTGGGGATGGTGGAGGG - Intergenic
969838085 4:9859878-9859900 TGTGACAAGCGGCCTCTGCAAGG + Intronic
972555692 4:40178725-40178747 TGAGACATGCGAAATGTGTAGGG + Intergenic
973754589 4:54062689-54062711 TTTGACATGAGGAATGTAGAAGG + Intronic
973956513 4:56068448-56068470 TGAGACAGGCAGACTTTGGAGGG + Intergenic
986280582 5:6318829-6318851 TAAGACATGGGGACTTTGGAAGG + Intergenic
991405024 5:66293324-66293346 GGTGACATGCAGCCTGAGGACGG + Intergenic
992744065 5:79801969-79801991 TGTGGCAAGGGGACGGTGGAAGG + Intergenic
994415849 5:99469287-99469309 TGTCACATTCGGACTATGGAAGG + Intergenic
994464121 5:100105829-100105851 TGTCACATTCGGACTATGGAAGG - Intergenic
996516303 5:124373203-124373225 TAGGACATGCGGACTTTGTAAGG - Intergenic
1001648967 5:173301930-173301952 TGTGACGTACGGACTCTGGCTGG + Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1011699611 6:89943183-89943205 TGTGACATCTGGACAGTGCATGG + Intronic
1018937332 6:168282357-168282379 TGTGACATTGGGAATGAGGAGGG + Intergenic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023592572 7:41795252-41795274 TGAGGCCTGCGGACTGAGGAAGG - Intergenic
1023831040 7:44039158-44039180 GGTGACAGGTGGACTGAGGAAGG + Intergenic
1029741366 7:102493463-102493485 GGTGACAGGTGGACTGAGGAAGG + Intronic
1029759356 7:102592632-102592654 GGTGACAGGTGGACTGAGGAAGG + Intronic
1029776725 7:102688542-102688564 GGTGACAGGTGGACTGAGGAAGG + Intergenic
1031068359 7:117133593-117133615 TGTGACATGGGGACGGTGATAGG + Intronic
1031105096 7:117531124-117531146 TGTGCCATGGGGCCTGTGCAAGG - Intronic
1034418518 7:150977560-150977582 TGTGACACGCTGAGTGTGCAGGG - Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1038946106 8:32361902-32361924 TGTGACATGAGGGATGGGGAAGG - Intronic
1040278161 8:46024423-46024445 TGTGAGACACGCACTGTGGATGG + Intergenic
1041044608 8:53878908-53878930 TGTGACATGCGGTATGCAGAAGG - Intronic
1041365169 8:57094729-57094751 TGTGCCATGCTTACTGTGGTGGG + Intergenic
1047819236 8:128500492-128500514 TGTGACATGAGGACTGGTGCTGG - Intergenic
1048766596 8:137851495-137851517 TGTGGCATGTGGACTCTAGAGGG - Intergenic
1049345380 8:142135944-142135966 TGTGACGTGGGGGCTGTGGCTGG - Intergenic
1049672744 8:143877134-143877156 CGTGAGATGCGGCCTGTGGCTGG + Intronic
1052235654 9:26210960-26210982 TGTGATATCTGGACTGTGGTTGG - Intergenic
1052389030 9:27856348-27856370 TGGGTCTTGCTGACTGTGGAAGG - Intergenic
1052552581 9:29969949-29969971 GGTGCCATGGGCACTGTGGATGG - Intergenic
1052820835 9:33136994-33137016 TGTGAGATGTGTACTGGGGAAGG - Intronic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1058826887 9:108783139-108783161 TGTGACTTTGGGACAGTGGAGGG - Intergenic
1060269076 9:122128451-122128473 TGTGGAGTGGGGACTGTGGAGGG - Intergenic
1061712414 9:132497463-132497485 TGTGGCCTGTGGACAGTGGAAGG + Intronic
1062117753 9:134818406-134818428 TGTGACACCCGGTCTGTGGTCGG + Intronic
1186877178 X:13828043-13828065 TGTGACATGAGCACTGTAGGAGG - Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1189996757 X:46646512-46646534 TGTGACATGTGTAGTGGGGAGGG + Intronic
1190118806 X:47643823-47643845 TGCCACATGTGGCCTGTGGAAGG - Intronic
1195870503 X:109480632-109480654 TGTGGCATGTGGCCTGAGGAGGG - Intronic
1196873491 X:120135669-120135691 AGTGACTTGCGGAGTGGGGAGGG - Intergenic
1200950532 Y:8894433-8894455 TGTCACATACTGCCTGTGGAGGG - Intergenic