ID: 1170769435

View in Genome Browser
Species Human (GRCh38)
Location 20:19319199-19319221
Sequence GACTCTACTGTCCCATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170769431_1170769435 27 Left 1170769431 20:19319149-19319171 CCTTTAGGGAAGTAGAAATAGAA 0: 1
1: 0
2: 5
3: 50
4: 588
Right 1170769435 20:19319199-19319221 GACTCTACTGTCCCATGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170769435 Original CRISPR GACTCTACTGTCCCATGAGC AGG Intronic
901945868 1:12703099-12703121 GTGTCTACTGTGCAATGAGCTGG + Intergenic
904802332 1:33102494-33102516 GGCTCTTCTGTCCCAGCAGCTGG + Intronic
914448151 1:147767764-147767786 GACACTGCTGTCAGATGAGCTGG - Intronic
923289104 1:232526897-232526919 GACTGTACTGACCCCTTAGCAGG - Intronic
1063921359 10:10936566-10936588 GACTCTTCTGCCCCAAGAACAGG - Intergenic
1065778492 10:29144508-29144530 CCTTCTACTGTCTCATGAGCTGG + Intergenic
1067180661 10:43983503-43983525 GACTCTCCAGTTCCAGGAGCTGG + Intergenic
1068374405 10:56159509-56159531 GACTCTACTATCACATGGACTGG - Intergenic
1075450257 10:122546389-122546411 GACTCTACTGTCCAAGCATCTGG - Intergenic
1076883127 10:133249228-133249250 GAGTCTCCTGTCCCCTGAGTGGG + Intergenic
1078731819 11:13981842-13981864 GACTCTGATGTCCCAGGAGCAGG - Intronic
1080665833 11:34335316-34335338 GACTTTACTGACCCATCATCTGG - Intronic
1090256374 11:125287486-125287508 GACTCCTCTGTCCCATGTGGCGG + Intronic
1102314938 12:111879979-111880001 CTCTCTAATGTCCCATGAGGAGG - Intronic
1104386832 12:128357959-128357981 GACACTCCTGGCCCCTGAGCAGG - Intronic
1104410858 12:128556559-128556581 CTCTCTACTCTCCCATGAACAGG + Intronic
1105728452 13:23187800-23187822 GATTATGCTGTCCCATGACCAGG + Intronic
1113705820 13:112432570-112432592 GACACACCTGTCCCTTGAGCAGG - Intronic
1121307753 14:92917657-92917679 GACTCTGCTGTTCCATGGCCTGG + Intergenic
1122959832 14:105089392-105089414 GGCTCTGCTGTCACCTGAGCTGG - Intergenic
1124346301 15:28923686-28923708 GACTATCCTGACCCCTGAGCAGG - Intronic
1134314214 16:13103423-13103445 GTCCTTAATGTCCCATGAGCAGG + Intronic
1138614486 16:58153996-58154018 GACTCCACTCTCCAATGAGCAGG - Intergenic
1141703327 16:85652196-85652218 AACTCTGCTGTCCTCTGAGCAGG + Intronic
1144095563 17:11897486-11897508 GACCATACTGTCCTATGAGGTGG - Intronic
1144299180 17:13907010-13907032 GGCTCCACTGTCCCATGAATTGG - Intergenic
1147559833 17:41501878-41501900 GATGCTGCTGTCCCTTGAGCTGG - Intronic
1149004724 17:51793646-51793668 GATTCTACTGTCCATTGTGCAGG - Intronic
1150113176 17:62520172-62520194 GGAACCACTGTCCCATGAGCTGG + Intronic
1151216400 17:72579785-72579807 GACTTTACTGTCCCATCTGTAGG + Intergenic
1153777447 18:8466448-8466470 GGCTCTACTGGCCCATGCCCAGG - Intergenic
1162207560 19:9067102-9067124 GACTCTACTTCCCAATGTGCTGG + Intergenic
1162378225 19:10317310-10317332 GACTTTACTGACCAATCAGCCGG - Exonic
1162726294 19:12691389-12691411 CACTGTGCTGTCCCAGGAGCCGG + Exonic
1163712384 19:18854388-18854410 GACTCTACCTCACCATGAGCCGG - Intronic
1163816001 19:19464896-19464918 GACTGCACTGTTCCAGGAGCAGG - Intronic
1164581520 19:29438307-29438329 GACTTTAGTGTCCCAGGATCTGG - Intergenic
1165471897 19:36008859-36008881 GACTCTTCTGTCACCTGAGCTGG - Intergenic
926070074 2:9880638-9880660 GTCTCTACTGACTCATGTGCAGG + Intronic
932267501 2:70381034-70381056 AAGTCTACTGACCCATAAGCAGG + Intergenic
933718748 2:85382917-85382939 GACTCTACCATCCCAGAAGCAGG + Intronic
937377945 2:121350557-121350579 GGCTACACTGTCCCATGAACAGG + Intronic
937627686 2:124061911-124061933 GATCCTACTATCCAATGAGCAGG + Intronic
946888191 2:224245959-224245981 GACTCTGGTGTCCCATGTGCAGG + Intergenic
947946694 2:234109614-234109636 CACACAACTGTCCCAGGAGCTGG - Intergenic
948353034 2:237356511-237356533 AACTCTACTGGCCCAAGTGCCGG + Intronic
1170769435 20:19319199-19319221 GACTCTACTGTCCCATGAGCAGG + Intronic
1172361084 20:34312815-34312837 GACTCCACTGTGCCAGGAGAGGG + Intergenic
1176083223 20:63284379-63284401 GACTCCACTGACCCAGGATCAGG + Intronic
1181148815 22:20867926-20867948 GACTCTGCTGTCACATTAGGAGG - Intronic
1182718420 22:32378156-32378178 GTCTCTACTGCCCCTTGTGCAGG - Intronic
1184677442 22:46051378-46051400 GAATGGTCTGTCCCATGAGCAGG + Exonic
953008853 3:39004636-39004658 GACTCTTCTTATCCATGAGCAGG + Intergenic
960836744 3:121914525-121914547 GACTCCACTGTCCTATGTTCTGG + Intronic
962191965 3:133319861-133319883 GATTCTTTTGTCCCATGAGGTGG - Intronic
962420717 3:135226303-135226325 CACTCTTCTGTCCCAGCAGCTGG + Intronic
964772065 3:160234801-160234823 GAGTCTCTTGTCACATGAGCTGG + Intronic
965345250 3:167540521-167540543 GACTCTTTTGTCCCATGGGGTGG - Intronic
975989504 4:80242871-80242893 GACTCAACCCTCCCCTGAGCAGG + Intergenic
979776503 4:124595046-124595068 CACTCTATTCTCCCAAGAGCTGG + Intergenic
984085567 4:175306583-175306605 GACTCTAATGTCCTAAGAGATGG + Intergenic
984990673 4:185377571-185377593 GGCTCTACTTGGCCATGAGCAGG - Intronic
986159614 5:5214997-5215019 GACTCTACTGTGCCCAGGGCTGG - Intronic
991975919 5:72183656-72183678 TCCTCTGCTGTCCCAGGAGCAGG + Intronic
993516225 5:88838501-88838523 GACTCTCCTGACCCATTATCAGG - Intronic
998870649 5:146548367-146548389 GATTCTACTGCACCACGAGCAGG - Intergenic
999717086 5:154369925-154369947 AGCTCTACTGTCCCATGCTCTGG - Intronic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1006675329 6:35758541-35758563 GAATGTTCTTTCCCATGAGCTGG + Intergenic
1006678356 6:35779520-35779542 GACTTTAATGTCTCAGGAGCTGG - Exonic
1010518399 6:76802830-76802852 GAATCTACTGGGCCCTGAGCTGG + Intergenic
1021593676 7:22292226-22292248 TTCTCAGCTGTCCCATGAGCTGG - Intronic
1025976170 7:66371861-66371883 TACTCTACTGGCCTTTGAGCAGG + Intronic
1029117780 7:98246201-98246223 GACTCTGATGTCCCCTGGGCTGG - Intronic
1031094101 7:117398769-117398791 TACTCTAATATCTCATGAGCTGG + Intronic
1032042390 7:128574109-128574131 GGAACCACTGTCCCATGAGCTGG + Intergenic
1035045720 7:155964142-155964164 GACTCCACTTACCTATGAGCAGG - Intronic
1038279389 8:26150006-26150028 CACTCTATGGTCCCATGAACAGG + Intergenic
1040790614 8:51224485-51224507 GACACCACTGTTCCATGAGTGGG - Intergenic
1041378167 8:57223384-57223406 CCCAGTACTGTCCCATGAGCAGG - Intergenic
1047353126 8:124094889-124094911 GACTCCACTGTCTCATCTGCAGG - Exonic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049577642 8:143397105-143397127 GACTCCTCTGTTCCAGGAGCTGG + Intergenic
1051049675 9:12916198-12916220 CACTCAACTGTACAATGAGCTGG + Intergenic
1056026742 9:82505268-82505290 GACTCTTTTGTCCCATGGGCTGG - Intergenic
1056830545 9:89913396-89913418 GACATTACTCTCCCATGACCAGG - Intergenic
1056904731 9:90635702-90635724 GACTCTAGTCTCCCATGGCCTGG - Intronic
1057500457 9:95593682-95593704 GACTCTGCTGTCCCCTAAGTCGG + Intergenic
1057500540 9:95594060-95594082 GATTCTACTGTCCCCTAAGTCGG + Intergenic
1057500570 9:95594186-95594208 GACTCTGCTGTCCCCTAAGTGGG + Intergenic
1057500601 9:95594312-95594334 GACTCTGCTGTCCCCTAAGTCGG + Intergenic
1058709745 9:107668898-107668920 GCCGTTACTGTCCCATGAGCTGG - Intergenic
1187009346 X:15264451-15264473 GACTCTCCTGTCCAAGGAGCAGG - Intronic
1192191057 X:68991401-68991423 GACTCGACAGTCCCATCAACTGG + Intergenic
1194589170 X:95775551-95775573 CACTCTACTATCCAATGAACTGG - Intergenic
1197815560 X:130494453-130494475 GCCTCCACACTCCCATGAGCAGG - Intergenic
1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG + Exonic
1201585057 Y:15551456-15551478 AACTCTAAGGTCCTATGAGCAGG + Intergenic