ID: 1170770960

View in Genome Browser
Species Human (GRCh38)
Location 20:19332151-19332173
Sequence TAGCAGAGGGAGTCCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170770953_1170770960 27 Left 1170770953 20:19332101-19332123 CCATCTAAGGTCTTGTCTGCCAT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 291
1170770956_1170770960 8 Left 1170770956 20:19332120-19332142 CCATGGTAAGGAGTTTAGATTTT 0: 3
1: 23
2: 111
3: 318
4: 1138
Right 1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170770960 Original CRISPR TAGCAGAGGGAGTCCATGGA AGG Intronic
900846534 1:5107357-5107379 AGGCGGAGGGAGTCCAGGGAGGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903031910 1:20469780-20469802 TAGCAGATGGAGTAAGTGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903339657 1:22645704-22645726 TAGAAGAGGGAGTCCCTGAAAGG - Intronic
903393513 1:22981930-22981952 TAGCAGATGGATTCCAGAGAGGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905223243 1:36463550-36463572 TCCCAGAGGGAGTGCATGGCTGG - Intronic
905324655 1:37142392-37142414 AAGCAGAGTGAGACCATGAAGGG + Intergenic
905874433 1:41423126-41423148 TGGCAGAGGGGGTCCCTGGAGGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908021188 1:59900746-59900768 TAGCAGAGGCAATGAATGGAGGG + Intronic
908315982 1:62933178-62933200 TTGCTGAGGGAGCCCAGGGAGGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910892287 1:92030275-92030297 TAGCAGTGGGTGCCCAAGGAGGG - Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914747719 1:150511909-150511931 CAGCAGGGGGGGTACATGGATGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916712625 1:167425370-167425392 TAGAAGAGTGAGGCCAGGGAAGG + Exonic
917481054 1:175412595-175412617 AGCCAGAGGGAGTCCATGAAAGG - Intronic
917646341 1:177032542-177032564 CTGCAGAGGGAGTGCATGAACGG - Exonic
920034940 1:203059638-203059660 GAGCAGAGGAAGTCCAGGGTGGG + Intronic
920764766 1:208821648-208821670 CAGCAGATGGAATCCAGGGAAGG + Intergenic
921238820 1:213155237-213155259 TAGCTGAGGCAGTCAAGGGAGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924440612 1:244082437-244082459 GAGCAGTGGGAGGCCATGGAAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064134146 10:12736028-12736050 TGGCAGAGGGAGCTCATGCAGGG + Intronic
1067024832 10:42836039-42836061 AAGCAAAGGGAAGCCATGGAAGG - Intergenic
1068693775 10:59944279-59944301 TGGCCAAGGGAGTCCAAGGAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069676865 10:70254941-70254963 TATCTGAGGGGGTCCAGGGAGGG - Exonic
1069998841 10:72361044-72361066 TGAAAGTGGGAGTCCATGGAGGG - Intergenic
1070031916 10:72685207-72685229 TAGAAGAGGGAGGCCAGGCATGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1075663582 10:124215173-124215195 TAGCAGAGGAAGGCCAGGGAAGG - Intergenic
1076154054 10:128189154-128189176 TAGCAAAGTGAGACCATGAAAGG + Intergenic
1076449982 10:130550610-130550632 TGGCAGAGGAAATTCATGGAAGG + Intergenic
1077211403 11:1372409-1372431 TTGCTGAGGGAGGCCATGGTTGG - Intergenic
1077537787 11:3132748-3132770 TAGCACTGGGAGTCCTTGGAGGG + Intronic
1077914151 11:6600325-6600347 GAGCAGAGGCAGTACATAGAGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078471390 11:11589808-11589830 TAGCCCAGATAGTCCATGGAAGG + Intronic
1080893143 11:36426997-36427019 GAGCAGAGGGTGGCCATGGGTGG - Intronic
1083693832 11:64429455-64429477 GAGCAGAGGCAGTCCCTAGAAGG + Intergenic
1083741904 11:64715729-64715751 GGGCAGAGGCAGTCCTTGGAGGG - Intronic
1084521016 11:69662910-69662932 TAGGAGAGGCAGTGCCTGGATGG - Intronic
1085259734 11:75197576-75197598 GAGCAGTGGGAAGCCATGGATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087240290 11:95767497-95767519 AAGCAGAGGGAATCAGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090516932 11:127438711-127438733 TAGCAGTGGAAGGCAATGGAGGG - Intergenic
1090879384 11:130820401-130820423 AAGGACAGGGAGACCATGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091691286 12:2599193-2599215 TAGAAGAGGGAGGGGATGGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092904703 12:13090895-13090917 GAGCGGAGGGAGTGCAGGGAAGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096181907 12:49555823-49555845 TGGCAGAGGGAGGCCAGGCAGGG + Exonic
1096409115 12:51364614-51364636 AAGCACAGGGAGGCCCTGGATGG + Intronic
1097692665 12:62747841-62747863 GAGCAGAGGGAGTACTTGGTGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100365737 12:93918728-93918750 CAGCAGAGGGGTTCCATGAATGG + Intergenic
1101077003 12:101140800-101140822 TAGCAGATGTAGAACATGGAAGG - Intergenic
1102077698 12:110073217-110073239 CAGCAGAGAGAAGCCATGGAAGG - Intronic
1104893726 12:132152007-132152029 GAGCACAGGGAGGCCATGGCTGG + Intronic
1106677965 13:31981849-31981871 TAGCAGTGGGGATCCAAGGAGGG - Intergenic
1107568532 13:41631463-41631485 TATGACAGGGAGTCCATGTAAGG - Intronic
1113673060 13:112188087-112188109 TGGCACAGGGAGTCCAAGGCAGG + Intergenic
1113726039 13:112602689-112602711 TAGCAGTGGCAGTGCATGGTTGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117713523 14:58557312-58557334 TAGAAGAGGGAGTCAATGGTGGG + Intergenic
1117814681 14:59584706-59584728 AAGCAGGGGGATTCCATGGCAGG - Intergenic
1120848520 14:89147558-89147580 GAGCAGAGGAAGGCCAAGGAAGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123163382 14:106301822-106301844 TAGCAAAGTGTGTCCATGGTGGG + Intergenic
1123425465 15:20167491-20167513 AAGCAAAGGGATGCCATGGAAGG - Intergenic
1123534687 15:21174009-21174031 AAGCAAAGGGATGCCATGGAAGG - Intergenic
1125316966 15:38441929-38441951 CAGCTGAGTGAGTCCAGGGAGGG + Intergenic
1125697095 15:41647930-41647952 TACCACAGGGAATCCATGGAGGG - Intronic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126793819 15:52243912-52243934 TGGCAGAGGGGGTCCCTGCAAGG - Intronic
1127485273 15:59412753-59412775 CAGCAGAGACAGTCCAGGGAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127706860 15:61556036-61556058 CAGCAAAGGTAGTCTATGGAGGG + Intergenic
1128527263 15:68421116-68421138 TAGCAGATGGGAGCCATGGAAGG + Intronic
1128527530 15:68422606-68422628 TAGCAGATGGGAGCCATGGAAGG - Intronic
1129543360 15:76369973-76369995 TAGTAGAGGGAGCCCAATGACGG - Intronic
1130731023 15:86492341-86492363 TAGCAAAGGGAGGCCAAGGTGGG + Intronic
1134188109 16:12100068-12100090 CAGCATAGGGAGTCCTTGGTGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136858779 16:33682031-33682053 AAGCAAAGGGAAGCCATGGAAGG + Intergenic
1136984265 16:35084562-35084584 GAGCAGAAGGGGTCCATGGCAGG + Intergenic
1137592249 16:49700759-49700781 CAGCAGAGGGGGCCCAAGGAGGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139978652 16:70835530-70835552 GAACAGAGGGAGTACAGGGAAGG + Intronic
1140294032 16:73690544-73690566 TTGCAAAGGGAGTGCATGAAGGG - Intergenic
1203120355 16_KI270728v1_random:1530524-1530546 AAGCAAAGGGAAGCCATGGAAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1145250791 17:21295869-21295891 GAGCAGAGAGAGTGCAGGGAGGG + Intronic
1145758372 17:27409261-27409283 TGGCAGAGCGCCTCCATGGAAGG - Intergenic
1146170024 17:30625562-30625584 TGGCAGCAGGAGCCCATGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146343477 17:32041591-32041613 TGGCAGCAGGAGCCCATGGAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1150965289 17:69960897-69960919 TAACAGAGGCAATCCTTGGAAGG + Intergenic
1151502449 17:74500013-74500035 TTGCATAGGGAGGTCATGGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152141660 17:78540622-78540644 TAGGTGTGTGAGTCCATGGATGG + Intronic
1155343421 18:24835799-24835821 TTTCAGAAGGAGTCCTTGGAGGG + Intergenic
1157326831 18:46675093-46675115 TAGCAGAGGGGTTGCAGGGAGGG + Intronic
1159345525 18:67198358-67198380 TCACAGAGGCAGTTCATGGATGG + Intergenic
1161620513 19:5294591-5294613 TAGCAGTGGGAGGGCATGGACGG - Intronic
1161680218 19:5676405-5676427 GAGCAGGGGGAGTCCATAGGCGG - Intronic
1162469651 19:10864804-10864826 GAGAAGAGGGAGGCCAAGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162808521 19:13151167-13151189 TATCTGAGGGAGTCCTCGGAGGG + Intronic
1164603534 19:29579627-29579649 GAGCAGATGGAGACCAGGGAGGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167980750 19:53272986-53273008 TAGGAGAAGGAGGACATGGAAGG + Intergenic
1168625000 19:57911100-57911122 CAGCAGAGGGTGGTCATGGATGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926538695 2:14147112-14147134 TGGCAGAGGCAGTCCAGGGTTGG - Intergenic
927080495 2:19625015-19625037 TACCAGACGGTGTCAATGGAAGG - Intergenic
927484552 2:23479546-23479568 AAGCAGAGGGAGTGGAGGGAGGG - Intronic
927694606 2:25231286-25231308 TAGCACAGGGACTCCACTGAGGG + Exonic
927740750 2:25567661-25567683 TAGTAGAGGGCCTTCATGGAGGG - Intronic
927912201 2:26907634-26907656 CAGCATGGGGTGTCCATGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928107119 2:28477699-28477721 AAGCAGAGGGAGGCCAGGAAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928664462 2:33536931-33536953 TAGCAGTTGCTGTCCATGGATGG + Intronic
928884981 2:36138072-36138094 TCTCAGAGGGAGTTCATGCATGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929963999 2:46520128-46520150 TAGAAGTGGGAGTGCAGGGAGGG - Intronic
931697085 2:64879476-64879498 CAGCAGGGCGAGTCCAGGGAGGG + Intergenic
932448662 2:71795890-71795912 TAGGAGAGGGAGCCCACTGAGGG + Intergenic
932564129 2:72894949-72894971 TAGCTGGGGGAGCCGATGGAGGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
933887187 2:86729664-86729686 GAGCAGATGGAGTGCCTGGAGGG + Intronic
934615146 2:95765938-95765960 AAGGAGGGAGAGTCCATGGAGGG - Intergenic
935318999 2:101867053-101867075 GAGCAGAGGGGGCCCAAGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936050801 2:109222516-109222538 CAGCAGAGGGAGTGCATTGTTGG + Intronic
936052217 2:109233124-109233146 TAGCAGTTGCTGTCCATGGATGG + Intronic
937092864 2:119218113-119218135 CAGCAGGGGCAGTCCATGCAGGG - Intergenic
937159317 2:119745449-119745471 TTGAAGAGAGAGTACATGGAAGG + Intergenic
938107403 2:128542733-128542755 TCCCAGAAGGAGTCCAGGGATGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938695174 2:133828388-133828410 AAAGAGAGGGAGTCCAGGGAAGG + Intergenic
939667115 2:144965629-144965651 TAGCAGAGGTTATCCATGAAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944665428 2:201955347-201955369 TAGCAAAGGGAGTCAAATGAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945662929 2:212708567-212708589 TAGAAGAGGGAGTTCTTGGAAGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946944434 2:224805939-224805961 TAGAAGAGGAAGTCACTGGATGG + Intronic
947467139 2:230361296-230361318 AAACAGAGGGATTCCCTGGAAGG - Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
949063719 2:241976410-241976432 CAGCAGAGAGAGGACATGGATGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169141542 20:3229818-3229840 TGGCAGGGGGAGGCCCTGGAGGG + Intronic
1169897679 20:10521854-10521876 GAGCAGAGGGAGTGCAGAGATGG + Intronic
1170412581 20:16107192-16107214 TAGCAGAAAGAGTCAATGGGCGG + Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1172134309 20:32676694-32676716 CAGCAGAGGGAGTGCAGGCATGG + Intergenic
1172518962 20:35555081-35555103 TACCAGATGGAAACCATGGAGGG + Intronic
1175537591 20:59725656-59725678 TGGCACAGGGAGGCCAAGGAGGG + Intronic
1176268190 20:64221592-64221614 TGGCGGAGGGAGGCCAGGGAGGG + Intronic
1177255237 21:18652888-18652910 CAACAGAGAGAGTCCATGAAGGG - Intergenic
1178003756 21:28193296-28193318 TAGCAGAGGAAGTTCTTGGTGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185193377 22:49452806-49452828 TAGATGAGTGAGTCGATGGATGG + Intronic
950892319 3:16414969-16414991 TGACAGAGGAAGTCCGTGGAGGG + Intronic
953208837 3:40856457-40856479 TTGCAGCTGGAGTCCATAGATGG - Intergenic
953580140 3:44146211-44146233 TACCAGAGAAGGTCCATGGAGGG + Intergenic
953803496 3:46047892-46047914 CAGGACAGGGGGTCCATGGACGG + Intergenic
953907271 3:46874651-46874673 CAGCAGCGGGAGCCCATGCAGGG + Intronic
954293435 3:49661625-49661647 CAGCAGTGGGCGTCCAGGGAAGG + Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
955811614 3:62796593-62796615 TAGCAGAGAGAGTCTAGGCATGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960294614 3:115927777-115927799 AAGCAGCGGGAGTGTATGGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961355704 3:126338788-126338810 CAGCTGAGGGAGGCCAGGGAAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964958580 3:162393992-162394014 AAGGAGAGGGAGTTCATTGAAGG + Intergenic
966055121 3:175677617-175677639 TAGATGAAGGAGTCCCTGGAGGG - Intronic
966750048 3:183313324-183313346 TAGCAGAAGGAGACACTGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966929059 3:184664022-184664044 ATGCAGAGAGAGCCCATGGAGGG - Intronic
967356567 3:188578417-188578439 TAGCAGGGGTAGTCCTGGGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
969658369 4:8510775-8510797 TAGCACATGGAGGCCAAGGAGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971978412 4:33721312-33721334 TAGCAGAGGGAGAATAAGGATGG + Intergenic
972202413 4:36730185-36730207 TAGTGGAGGGAGTCTATGGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979952082 4:126906022-126906044 TAGCAGCGGGTGTGCAAGGAAGG - Intergenic
980534114 4:134092565-134092587 TAGCAGTGGCAGTCCATAGATGG - Intergenic
980871499 4:138615939-138615961 TAGCAGTTGCTGTCCATGGATGG - Intergenic
982034241 4:151329997-151330019 TAGAAGAGTGAGTCCATGAGTGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982287640 4:153752106-153752128 TAGAAAAGGTAGTCCATGGGTGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985607719 5:867306-867328 TAGCAGAGGTTCTCCATGAAGGG - Intronic
985666821 5:1185679-1185701 GAGCAGAAGGGTTCCATGGATGG + Intergenic
985677057 5:1237603-1237625 TGGGAGAGGGAGGCCAGGGAGGG + Intronic
986486140 5:8239851-8239873 TAGCAGATGGAGCCCCTCGAGGG - Intergenic
986638094 5:9844252-9844274 TAGCAATGGGAAGCCATGGAAGG - Intergenic
988195422 5:27998840-27998862 TAGCAGTGGGATACCATAGAAGG + Intergenic
989128049 5:38075904-38075926 TAGAAGAGGGACTCCAAGGTAGG - Intergenic
989406365 5:41065531-41065553 GGGCAGAGTGAGTCTATGGAGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994210609 5:97084406-97084428 GAAGAGAGGAAGTCCATGGAGGG - Intergenic
994832284 5:104800549-104800571 TGGCAGAGGGAGCACATGGTAGG - Intergenic
1001316403 5:170644092-170644114 CAGCAGAGGAAGCCCATAGAGGG + Intronic
1001454156 5:171848109-171848131 AAGGAGAGGGAGTTCAGGGAGGG - Intergenic
1002206483 5:177566298-177566320 CAGCAGAGTGAGTCCACAGATGG - Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004118403 6:12794353-12794375 AAGCAGAGGAAGTACTTGGATGG + Intronic
1004418322 6:15445516-15445538 TAGCTTAGGGAGTGGATGGATGG + Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008583894 6:52931509-52931531 TAGCAGAGGAAGGTCAGGGAAGG - Intergenic
1009580280 6:65524761-65524783 TAGCAGAAGGATTGCATGTAGGG + Intronic
1009865654 6:69394566-69394588 TAGCTGATTGAGCCCATGGATGG - Intergenic
1010490064 6:76465204-76465226 TAGCAGTGGGTGTCCTTAGATGG - Intergenic
1012617486 6:101294499-101294521 CAGGAGAGAGAGTCCATGCAGGG + Intergenic
1013135046 6:107274041-107274063 TAGCAGAGCTAGTCCATTGCAGG + Exonic
1014183355 6:118408405-118408427 TAGCAGAGCGTGGCCAGGGATGG + Intergenic
1015474366 6:133643588-133643610 TTGCAGAGGAAGTTCATGGTAGG - Intergenic
1017201380 6:151758468-151758490 TAGAAGAGGAAGGCCAGGGATGG + Intronic
1018024386 6:159792540-159792562 TAGAGGAGGGAGTCCAAGAAAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019572951 7:1721792-1721814 TGGCAGAGGGAGGTCCTGGAAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026892850 7:73992491-73992513 TTGCAGGGGAAGTCCCTGGAAGG + Intergenic
1027187692 7:75981746-75981768 TGGCAGAGTGAGTCCTTGGCTGG - Intronic
1027243020 7:76345559-76345581 GACCAGTGGGAATCCATGGAGGG - Intronic
1027946951 7:84759123-84759145 TAGCAGATGGCCTCCATTGAAGG + Intergenic
1028127172 7:87126601-87126623 TAGCAAAGGAAGTACAGGGATGG + Intergenic
1028721097 7:94032546-94032568 TTGCTGAGGGATTTCATGGAAGG + Intergenic
1028864404 7:95691239-95691261 GAACAGATGCAGTCCATGGAAGG + Intergenic
1029406018 7:100374388-100374410 CAGCAGTGGCAGTCCATCGAGGG + Exonic
1032404916 7:131649049-131649071 TAGCAAGGAGAGTCCAAGGAAGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035972807 8:4270380-4270402 TGGCCGAGGGAGATCATGGATGG - Intronic
1037087872 8:14875422-14875444 TAGCAGAAGGATTCAATGGGAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039329655 8:36523317-36523339 TAGCAGAGGGAAACCATTGAAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1043533113 8:81171976-81171998 GAGCAGAGAGAGACCAGGGACGG + Intergenic
1044025642 8:87168565-87168587 TAGCAGAGGGAGTCGGGGGTGGG - Intronic
1044848871 8:96408530-96408552 CAGCTGAGGCAGTCCCTGGAGGG - Intergenic
1044945608 8:97386104-97386126 TAGCAGGGGGAATCATTGGAGGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047017407 8:120738039-120738061 TAGGAGATGGGGTCCTTGGAGGG + Intronic
1050278414 9:4024618-4024640 TAACATAGGGAGTGCATGGGAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051598355 9:18847779-18847801 TAACAGAGGGAGTACACAGAAGG + Intronic
1059620715 9:116002601-116002623 TGGCACAGGGAGTCCAAGAAGGG + Intergenic
1059950638 9:119459010-119459032 TAACAGTAGGAGTACATGGAAGG - Intergenic
1060027480 9:120185302-120185324 TAGCAGAGGCAGTCTTTGAAGGG - Intergenic
1060079250 9:120625936-120625958 TAACAGAGAGAGACCATGAAAGG - Intronic
1060173230 9:121478601-121478623 AAGCAGGGGAAGTGCATGGAAGG + Intergenic
1060989155 9:127838420-127838442 AGGCAGTGGGAGGCCATGGAAGG - Intronic
1061533636 9:131233987-131234009 TCGCAGAGTGCGTCCTTGGATGG - Exonic
1062115470 9:134805924-134805946 TAGAAGAGGGAGCCCATTGAAGG + Intronic
1186767491 X:12785879-12785901 TAGGAGAGGCTGTGCATGGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1198633451 X:138668921-138668943 TAGCAGGAGGAGTTCATGGATGG + Intronic