ID: 1170771071

View in Genome Browser
Species Human (GRCh38)
Location 20:19332902-19332924
Sequence GCATCCTCCCTAAATTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170771071_1170771073 11 Left 1170771071 20:19332902-19332924 CCAGGACAATTTAGGGAGGATGC No data
Right 1170771073 20:19332936-19332958 TTCTGGTTTTGTCTCCTCCCAGG No data
1170771071_1170771072 -6 Left 1170771071 20:19332902-19332924 CCAGGACAATTTAGGGAGGATGC No data
Right 1170771072 20:19332919-19332941 GGATGCTCTAAATAGCTTTCTGG No data
1170771071_1170771076 27 Left 1170771071 20:19332902-19332924 CCAGGACAATTTAGGGAGGATGC No data
Right 1170771076 20:19332952-19332974 TCCCAGGGTCAGATGAACTGAGG No data
1170771071_1170771074 12 Left 1170771071 20:19332902-19332924 CCAGGACAATTTAGGGAGGATGC No data
Right 1170771074 20:19332937-19332959 TCTGGTTTTGTCTCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170771071 Original CRISPR GCATCCTCCCTAAATTGTCC TGG (reversed) Intronic