ID: 1170771229

View in Genome Browser
Species Human (GRCh38)
Location 20:19334499-19334521
Sequence GTGAAAAAGATGATCACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170771229 Original CRISPR GTGAAAAAGATGATCACTTA TGG (reversed) Intronic
902165878 1:14571356-14571378 ATGAAAAAGGTGAGCAATTATGG - Intergenic
902333883 1:15744005-15744027 GTGAGAGAGATGATCCCCTAGGG + Intronic
906538869 1:46569574-46569596 CTGAAAAAGTTGATCACCGACGG - Intronic
907164214 1:52395973-52395995 GTGATAAAAATGATAATTTATGG - Intronic
907430948 1:54410935-54410957 TTGAAAAAGATGATTACTCATGG + Intronic
907719922 1:56962179-56962201 ATGGGCAAGATGATCACTTACGG + Intronic
910867515 1:91801949-91801971 GTGAAAAAAATTAAGACTTAAGG + Intronic
911479580 1:98421399-98421421 TTGAAAAATATGATAACATAAGG + Intergenic
912183339 1:107245073-107245095 ATGTGAAAGATGAACACTTATGG - Intronic
913657656 1:120976505-120976527 GTGAAGATGCTGATCACTAAAGG - Intergenic
914009007 1:143759587-143759609 GTGAAGATGCTGATCACTAAAGG - Intergenic
914350816 1:146838501-146838523 CTGAAAAATATAATAACTTAAGG - Intergenic
915364870 1:155309448-155309470 GTGTAAAATAGGATGACTTAAGG + Intronic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
921242348 1:213198427-213198449 TTGCAAAAGATCATCACCTAAGG - Intronic
921373512 1:214449870-214449892 GTGAAAAAAATAAGCACTTTGGG + Intronic
921778165 1:219127018-219127040 GTGAAAAAGATGACCACAATAGG + Intergenic
922014866 1:221635024-221635046 GTTAAAAAGATGATCATTCAAGG - Intergenic
924590577 1:245400294-245400316 GTGAAAAGGATAAATACTTAGGG - Intronic
924683799 1:246266555-246266577 TTAAATAAGATTATCACTTAGGG - Intronic
1063646915 10:7894315-7894337 GTGAAAAAAATTACCACCTAAGG + Intronic
1064121072 10:12619953-12619975 GTGAAAAAGAAGATCCCAAAAGG - Intronic
1064560033 10:16586773-16586795 GTTAATAAAATGAACACTTAAGG + Intergenic
1066608383 10:37207599-37207621 GTGAAAAATTAGGTCACTTATGG + Intronic
1067394293 10:45899154-45899176 GTTAAAAAGATGACTACGTAAGG - Intergenic
1067862619 10:49868285-49868307 GTTAAAAAGATGACTACGTAAGG - Intronic
1068075482 10:52248360-52248382 GTGGAAAAGATAAACAGTTATGG + Intronic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1072336269 10:94401665-94401687 GAAAAAAAGATTATCACCTAAGG - Intergenic
1077794103 11:5472679-5472701 CTGAAAATGTTGATCACTTCAGG - Intronic
1080105025 11:28502797-28502819 GTGAAAAAGAGCAGAACTTATGG + Intergenic
1081277995 11:41174233-41174255 ATGAATAAGCTTATCACTTAAGG + Intronic
1082573387 11:54770751-54770773 GTGAAAAAGAAAATAACTTCAGG + Intergenic
1088268737 11:108012246-108012268 ATGAAAAAAATGAGCACTAAGGG - Intronic
1088929001 11:114330143-114330165 GTCAAAAAGATAATCAATTAGGG - Intergenic
1089331104 11:117689608-117689630 GTGAAGGAGATGATCACTCAAGG + Intronic
1091264535 11:134260421-134260443 GTGAGAAAGAGGTACACTTAGGG - Intronic
1092962023 12:13605404-13605426 TTGAAAAAGATGAACAGTTGTGG + Intronic
1094299677 12:28948693-28948715 GTGAAACAGATGTTCATTGAAGG - Intergenic
1094744132 12:33323796-33323818 GTGAAAAACAAGAGCACTTGTGG - Intergenic
1098361918 12:69663025-69663047 GTAAAGAAGATAATCCCTTAAGG - Intronic
1099091289 12:78312778-78312800 GTGAAAAAGAAAAACACCTACGG - Intergenic
1099508043 12:83502857-83502879 CTTAAAAATATGTTCACTTAAGG + Intergenic
1101048490 12:100836195-100836217 GTGAAAATGTTGATCTGTTAGGG + Intronic
1104568559 12:129905306-129905328 GTGAAAGAGACAATCTCTTAGGG - Intergenic
1106712580 13:32353824-32353846 CTGAGAAAGATGATCACTTTTGG + Intronic
1106995276 13:35473527-35473549 CTGAAAAGGCTGATCACCTATGG - Intronic
1107096838 13:36546390-36546412 GTGAAAATGGTGCTTACTTACGG + Intergenic
1107579055 13:41762552-41762574 GTGAGAAAGGAGATAACTTAAGG - Intronic
1107780893 13:43901301-43901323 GTGAAAAAGATGATCACAGTTGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1112209249 13:97358620-97358642 GTGAAAAACATGGTCAATTATGG - Intronic
1112582499 13:100688511-100688533 TGGAAAAAGATGATAACTTCTGG + Intergenic
1114826675 14:26089478-26089500 GTGAAAAAGAAACTCTCTTAAGG + Intergenic
1115846497 14:37541368-37541390 GTGAAAAAGACGAGGACATAAGG - Intronic
1120120732 14:80677626-80677648 GTTAAAAAAAAAATCACTTAAGG + Intronic
1120470269 14:84914634-84914656 GTGAAAATTAAGATCACTAAGGG - Intergenic
1124971453 15:34494196-34494218 GTGAAAAAGATGAACAACTAGGG - Intergenic
1129421438 15:75430508-75430530 ATGAAATAGATGATCAGTTCTGG - Intronic
1132281546 15:100620450-100620472 GTCAAAATGATGAAAACTTAGGG + Intronic
1133054662 16:3139577-3139599 CTGAACAAGATGATCCCTGATGG - Intronic
1136350660 16:29705219-29705241 GTGGAAAAGATGATCATTTGTGG + Intergenic
1137050139 16:35703442-35703464 GTGAAAAAGATGATCCCTCGTGG + Intergenic
1138730321 16:59186983-59187005 CTTAAAAAGATAATTACTTATGG - Intergenic
1138977175 16:62221471-62221493 GTGTAAAAGATGACAATTTAAGG - Intergenic
1139983219 16:70877043-70877065 CTGAAAAATATAATAACTTAAGG + Intronic
1140347124 16:74224333-74224355 ATGAAAAAAATGATCATTTGGGG - Intergenic
1143238637 17:5424818-5424840 TAAAAAAAGATGATAACTTAAGG - Intronic
1143462066 17:7110157-7110179 GTGAAAAAGATGAAGAGTTATGG - Intronic
1143939059 17:10519614-10519636 ATGAATTAGATGATCCCTTATGG - Intergenic
1145917461 17:28583803-28583825 GAGAAAAAAATAAGCACTTAGGG + Intronic
1146328084 17:31904255-31904277 GGAAACAAGATGATCACTTGAGG - Intergenic
1146416266 17:32636049-32636071 GGGAAAAAGAGAATCACTGAAGG - Intronic
1146638031 17:34520358-34520380 GTGAAGAAGATGATCTCTAGGGG + Intergenic
1148926891 17:51094789-51094811 GTGAAAAGGATCATTACTTGGGG - Intronic
1156809370 18:41227948-41227970 GTGAAAAAGATGTTAGCTAAGGG + Intergenic
1156824985 18:41419928-41419950 GTGAAGGAGATTTTCACTTAAGG + Intergenic
1157137542 18:45071422-45071444 GAGAAAAAGATGCCCACTCAGGG - Intergenic
1158994104 18:62899670-62899692 GTGACAACGATGATGACCTATGG - Intronic
1164365180 19:27572317-27572339 GTGAAAAAGAAGATATCTTCAGG + Intergenic
1164368303 19:27613380-27613402 GTGAAAAAGAAAATCTCTTCAGG + Intergenic
1165059240 19:33196723-33196745 GTGAGAAAGATGTTCACTGTGGG - Exonic
1165646563 19:37443636-37443658 TTGAAAAAGATAATTACATAGGG + Intronic
1166689150 19:44812453-44812475 GTGAAAAAGACGTTCACGTCAGG - Intronic
925797143 2:7558145-7558167 GTGACAAAGCTAATTACTTAAGG + Intergenic
926947123 2:18200503-18200525 GTATAAAAGATAATGACTTAGGG - Intronic
928118862 2:28567120-28567142 GGGAAAAAGATCACCTCTTAGGG + Intronic
929201449 2:39241665-39241687 TTGAAAAAGATGAAGATTTAAGG - Intergenic
929423258 2:41816777-41816799 GGGCTAAAGAGGATCACTTAAGG - Intergenic
931376154 2:61710210-61710232 GCAAAAAAGATGATCACTGCGGG - Intergenic
932193275 2:69759441-69759463 GTGAAATAGATGATTGCTAAAGG + Intronic
933438557 2:82280778-82280800 GGAAAAAACATAATCACTTATGG + Intergenic
933856977 2:86424156-86424178 GTGAAAAACATCATAACTCAGGG + Intergenic
934510619 2:94938188-94938210 GTTAAAAAGATGACTACGTAAGG - Intergenic
935628536 2:105192280-105192302 GAGAAAAAGATGATGAAATAGGG + Intergenic
936366871 2:111865743-111865765 GTCAAAAATATGATCAATAATGG + Intronic
937525198 2:122760154-122760176 ATGAAAAAGATTATCATTGAAGG - Intergenic
939534572 2:143411557-143411579 AAGAAAAAGATGAACACATAGGG - Intronic
939667822 2:144972226-144972248 GTGAAAAAGATAAACACATATGG + Intergenic
940484367 2:154278174-154278196 GCGAAAAACATCATAACTTATGG + Intronic
940766163 2:157791667-157791689 GTGAAACAGAGGATGACTAACGG + Intronic
943139887 2:183969115-183969137 GTGGAAAAGATGACTTCTTAAGG + Intergenic
943625367 2:190192765-190192787 ATCAAAAACATGAACACTTAGGG - Intronic
945095993 2:206219912-206219934 TTTAAAAAAATGATCACTTTGGG + Intergenic
945414108 2:209549361-209549383 GAGAAAAAGATGATCATTTCTGG + Intronic
945897094 2:215495947-215495969 ATGAAAAATATGAACATTTAAGG + Intergenic
947896619 2:233680275-233680297 GAGTAAAAAATGATCTCTTATGG - Intronic
948366825 2:237460907-237460929 GTGCAAGAGATGATCTCTGAGGG + Intergenic
948469125 2:238166123-238166145 GTGCCAGAGATGGTCACTTAGGG - Intronic
948882001 2:240863719-240863741 TTGAAAAAGAGGATCTCTTAAGG - Intergenic
1169498552 20:6137474-6137496 GAGAAAAAGAACATCACTTCCGG + Intergenic
1170021652 20:11843134-11843156 GTGATAAAGTGGCTCACTTAAGG + Intergenic
1170528092 20:17261094-17261116 GTGGAAAATATGATTACTAAAGG - Intronic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1172311598 20:33922509-33922531 GTGCAAAAGATGATGACTGGTGG - Intergenic
1172416622 20:34774154-34774176 GTGAAAAACACTATCAATTAAGG + Intronic
1173121018 20:40289254-40289276 GAGAAAAAGATGAACATTTGTGG - Intergenic
1175469061 20:59213022-59213044 GTGACAAAGATGATAACTCTAGG + Intronic
1177088539 21:16737310-16737332 GTGAACATGCTGAACACTTATGG - Intergenic
1180028157 21:45180616-45180638 GTTAAAAAGATGAACATTTTGGG - Intronic
1181122171 22:20678272-20678294 GAGAAAAAGATCATCAATGAAGG + Intergenic
949585136 3:5429859-5429881 TTGAAGAAGATGATCACTAAAGG + Intergenic
953495232 3:43380349-43380371 CACAAAAAGATTATCACTTAGGG + Intronic
953701676 3:45200872-45200894 GAAAAAAAGATGCTCACTAATGG - Intergenic
955441916 3:58965361-58965383 GTGAAAAACATGAGCATTTGGGG + Intronic
955498154 3:59558066-59558088 ATGTAAAAGATGATGCCTTACGG + Intergenic
955576067 3:60364495-60364517 GTAAAACAAATGATCACTGAAGG + Intronic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
956045098 3:65187666-65187688 TTGAACAAAAGGATCACTTAAGG - Intergenic
956195271 3:66648121-66648143 GTGAAAAAGATGATATTTCAAGG + Intergenic
959354253 3:105305238-105305260 GCCACAAAGATGATCACTGAAGG + Intergenic
961773369 3:129266422-129266444 GTTAAAAAAAAAATCACTTAAGG - Intronic
963590739 3:147255134-147255156 ATGAAAAAAATGTCCACTTACGG + Intergenic
963952460 3:151217904-151217926 GTGGAAAAGAAGCTCTCTTAAGG + Intronic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964962639 3:162446971-162446993 TTGTAAAAGATGATCATTAAAGG + Intergenic
965638033 3:170804116-170804138 AAGAAAAAGATGATGACTTTTGG - Intronic
966178476 3:177165862-177165884 CTGAGTAAGATGATCACTTGAGG + Intronic
967659284 3:192085576-192085598 GAGAAAAAGATGCTGACCTAAGG - Intergenic
973571287 4:52242272-52242294 GAGAAAAAAATGATTACTTCTGG + Intergenic
977618664 4:99111946-99111968 GTGAACAAGATGACCACCTTGGG + Intergenic
978064631 4:104381316-104381338 GTAAAAAAGATGTGCAATTATGG + Intergenic
979662584 4:123275077-123275099 GTAAAAAAGACAATCACTCAAGG - Intronic
980972960 4:139584112-139584134 TTTAAACAGATTATCACTTAAGG + Intronic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981235479 4:142410325-142410347 GGGAAAGAGATGGTCACTTGGGG - Intronic
981935051 4:150230275-150230297 TTGAAAAAGATAATAACTTTTGG + Intronic
982381564 4:154754509-154754531 GTAAAGAATATGAACACTTAAGG + Intergenic
983466069 4:168092356-168092378 TTGAAAAAGCTGATGACTTATGG - Intergenic
986552629 5:8974929-8974951 GTGGAAAAGTTGAGCACTTGGGG + Intergenic
986968912 5:13308701-13308723 GTGAAAAATATGAGCCCATAGGG + Intergenic
987544745 5:19299620-19299642 ATGACAAAAATGATCACGTAAGG + Intergenic
988856444 5:35232166-35232188 GTGAAATAGAAGATCACTCTGGG + Intergenic
989489001 5:42028626-42028648 GAGAAAAACATGCTCACTAAAGG - Intergenic
989844280 5:46120830-46120852 GTGAAAAAGAAGATCTCTTCAGG - Intergenic
990166165 5:52995609-52995631 AGGAAAAAGATGATCAGTTCAGG + Intronic
990641325 5:57787070-57787092 CTGAAAAACATGATGATTTAGGG - Intergenic
990899987 5:60739499-60739521 GTGCCAACGATGTTCACTTAAGG - Intergenic
991289772 5:65022350-65022372 GTGACAAAGATCATCCCCTACGG - Intergenic
993694454 5:91043836-91043858 GTGAAAAAGATGACCAGGAAAGG - Intronic
994565450 5:101440241-101440263 GAGAAAAAGAAGATTACATAGGG + Intergenic
1003028163 6:2577045-2577067 GTGGAAAAGTGGATGACTTAGGG + Intergenic
1005417497 6:25616739-25616761 GTCAAATAGATGTTCCCTTAAGG + Intronic
1008285855 6:49649183-49649205 GTTAAATAGATGATGAATTAAGG - Intergenic
1008564333 6:52752231-52752253 GTAAAAAAGATGATGAATTCAGG - Intronic
1009063977 6:58434061-58434083 GTGAAAAAGAAAATATCTTAAGG + Intergenic
1009259942 6:61472989-61473011 GTGAAAAAGAAAATAACTTCAGG + Intergenic
1009261756 6:61499510-61499532 GTGAAAAAGAAAATAACTTCAGG - Intergenic
1009473550 6:64058703-64058725 GTGAAACAAATGAAGACTTAGGG - Intronic
1011463949 6:87635836-87635858 GAGAAAAAGAGGCTCATTTAAGG - Intronic
1011802901 6:91037884-91037906 GTGGCTAAGATGATCACTAAAGG - Intergenic
1012817155 6:104038572-104038594 TTGAAATACATAATCACTTAGGG - Intergenic
1013132614 6:107248673-107248695 TTGGAAAAGATGATTCCTTAAGG + Intronic
1015021487 6:128480954-128480976 GTGACAAAGAGAATGACTTAAGG - Intronic
1018321919 6:162620251-162620273 CTGAAAAAGATGTTGACTTAAGG - Intronic
1020908818 7:14102170-14102192 GAGAAAAAGAAGATGGCTTAAGG - Intergenic
1023308877 7:38861715-38861737 ATGAAAAAGGTGATCATTTCAGG - Intronic
1023598376 7:41856147-41856169 ATGCAAAAGTTGATCATTTAAGG + Intergenic
1023884144 7:44340033-44340055 GTCATAAAGATGATCACCTATGG + Intergenic
1025625619 7:63218656-63218678 AGGAAATAGATGATCACCTAGGG - Intergenic
1026174480 7:67984190-67984212 GTACAAAAGTGGATCACTTAAGG + Intergenic
1028126970 7:87124312-87124334 TTGAAAACAATGATGACTTATGG + Intergenic
1029727134 7:102414289-102414311 GAGAAAAAGGTGATCAATTCAGG - Intronic
1029790171 7:102835098-102835120 CAGGAAAAGATGATGACTTAGGG - Intronic
1030611613 7:111695932-111695954 GAGAAAAAGGGGATCACATAAGG - Intergenic
1033968645 7:147010419-147010441 TTGAAAAAAATGATGACTTTTGG + Intronic
1035735085 8:1881862-1881884 CTTTAAAAGATGATCTCTTATGG - Intronic
1037036280 8:14172085-14172107 CTGAAAAAGATGACCAGATAAGG + Intronic
1037467050 8:19171410-19171432 GACATAAAGATGAACACTTAAGG - Intergenic
1037626985 8:20616900-20616922 CTGAGACAGAGGATCACTTAAGG - Intergenic
1039104959 8:33980317-33980339 GTGCAAATGAAGATCTCTTAAGG + Intergenic
1039144392 8:34429885-34429907 CTGAAAAAGAAGATCCCATATGG - Intergenic
1040918139 8:52585122-52585144 GTGAAAATAAGAATCACTTAGGG + Intergenic
1042579721 8:70263476-70263498 GTGAAAAAGATGACCTTTTTTGG - Intronic
1043475817 8:80605274-80605296 GTGAAGAAGATGAGCACTGCAGG - Intergenic
1043934097 8:86123338-86123360 AAGAAAAAAATGATCACTTTTGG - Intronic
1046624313 8:116560626-116560648 AAGAAAAAGAGGAGCACTTAGGG + Intergenic
1050697825 9:8298752-8298774 GTGGACTAGATGTTCACTTAAGG - Intergenic
1051072813 9:13193398-13193420 GTGAGAAAGATGACCACTTTTGG - Intronic
1052224145 9:26064133-26064155 TTAAAAAAGATGAAAACTTATGG - Intergenic
1053319949 9:37088232-37088254 GTGAAACAGTACATCACTTAAGG - Intergenic
1053654779 9:40206146-40206168 GTTAAAAAGATGACTACGTAAGG + Intergenic
1053905169 9:42835361-42835383 GTTAAAAAGATGACTACGTAAGG + Intergenic
1054363350 9:64201881-64201903 GTGAAAAAGAAAATAACTTCAGG + Intergenic
1054366894 9:64352363-64352385 GTTAAAAAGATGACTACGTAAGG + Intergenic
1054529820 9:66170168-66170190 GTTAAAAAGATGACTACGTAAGG - Intergenic
1054674523 9:67842105-67842127 GTTAAAAAGATGACTACGTAAGG + Intergenic
1054894358 9:70291428-70291450 GTGAAACAGATGAGAACTTAGGG + Intronic
1058902536 9:109454645-109454667 GTGAAAAAATGCATCACTTATGG - Intronic
1186016924 X:5206961-5206983 GTGAAAAAAATTAGCATTTAAGG + Intergenic
1187716516 X:22107551-22107573 GTGAACAGGATCATCACTCAAGG - Intronic
1193186349 X:78517773-78517795 TTGAAAATGATAATCACTAAGGG + Intergenic
1193216570 X:78871236-78871258 GGGGAAAGGAAGATCACTTAGGG - Intergenic
1193414661 X:81207258-81207280 GGGAAATAGATGATTTCTTAGGG + Intronic
1194695709 X:97046883-97046905 GAAAAAAAGATCATCAGTTATGG + Intronic
1195534743 X:105998590-105998612 GTGAAGGACATGATCTCTTATGG - Intergenic
1195640511 X:107169652-107169674 ATGAATAAAATGATGACTTATGG - Intronic
1197054493 X:122100179-122100201 GACAAAAAGATTATCACCTAGGG - Intergenic
1197177559 X:123501581-123501603 CTGGAAAAGATGACCAGTTATGG - Intergenic
1198040948 X:132851826-132851848 TTGAAAAAGATCATCCCCTAAGG - Intronic
1200301376 X:154979958-154979980 GTGAAAATGAGGAACACTAAGGG + Intronic
1201448700 Y:14085956-14085978 TTGAAAAAGATTGTCATTTAGGG - Intergenic