ID: 1170773151

View in Genome Browser
Species Human (GRCh38)
Location 20:19351721-19351743
Sequence TCACCTCAGTTTCCACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170773148_1170773151 -5 Left 1170773148 20:19351703-19351725 CCCAAGGCTTCATGCACTTCACC 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1170773147_1170773151 -4 Left 1170773147 20:19351702-19351724 CCCCAAGGCTTCATGCACTTCAC 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1170773149_1170773151 -6 Left 1170773149 20:19351704-19351726 CCAAGGCTTCATGCACTTCACCT 0: 1
1: 0
2: 1
3: 27
4: 362
Right 1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG 0: 1
1: 0
2: 2
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170773151 Original CRISPR TCACCTCAGTTTCCACCAGG TGG Intronic
900197045 1:1381732-1381754 TCCCATCAGTTTCCTCCAGATGG + Intergenic
907309955 1:53533581-53533603 GTACCTCTGTTTCCACCTGGAGG - Intronic
908770684 1:67592895-67592917 TCACCTCAGTCACCTCCAGAAGG - Intergenic
911273384 1:95830844-95830866 CCGCCTCAGTTTCCTCCAGGGGG + Intergenic
911450209 1:98053078-98053100 TCAACTCAGTTTCCACTTGGCGG + Intergenic
921653639 1:217708121-217708143 TAACCTCAGATTGCACCTGGAGG + Intronic
921833480 1:219753673-219753695 TCACATGAGTTTTCACCATGTGG + Intronic
922221872 1:223614582-223614604 TCACCTCAGCTTCATCGAGGAGG - Intronic
923183865 1:231550538-231550560 CCACTTCTCTTTCCACCAGGGGG - Intronic
1063467486 10:6256564-6256586 ACACCTCTCTTTCCACAAGGTGG + Intergenic
1063759676 10:9058659-9058681 TGAGTTCAGTTTCCTCCAGGAGG - Intergenic
1065967955 10:30784143-30784165 TCAACTCAGTGGCAACCAGGGGG + Intergenic
1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG + Intronic
1068303572 10:55176387-55176409 TAATATCAGTCTCCACCAGGGGG - Intronic
1069723403 10:70563319-70563341 TCACCTCTGTTTCCCCCATCTGG + Intronic
1070398133 10:76030874-76030896 TCCCTTCATTTTCCACCAGGTGG + Intronic
1071014600 10:80980633-80980655 TCACTTCATTTTCAACAAGGGGG - Intergenic
1071227977 10:83553666-83553688 TCACCTCAGAATTCTCCAGGAGG + Intergenic
1071370589 10:84947365-84947387 TCACCTCACCTTCCACAAGATGG - Intergenic
1072939552 10:99748187-99748209 TCATCTCAGTTTCACACAGGGGG - Intronic
1073083765 10:100875507-100875529 TCACCACACTTGTCACCAGGAGG + Intergenic
1073755076 10:106572732-106572754 TGACTTCAGTTTCAACCTGGTGG + Intergenic
1074904271 10:117847248-117847270 CCACATCAGTGCCCACCAGGGGG + Intergenic
1075002766 10:118810246-118810268 GGACTGCAGTTTCCACCAGGGGG - Intergenic
1075091309 10:119445521-119445543 TTCTCTCAGTGTCCACCAGGGGG - Intronic
1077419041 11:2440970-2440992 TCACCTCATGTTCCTCCAGCAGG - Intergenic
1080403483 11:31957968-31957990 TCACCTGAGTTTTTACAAGGTGG + Intronic
1082142510 11:48626064-48626086 TCACCCCAGTGACCAACAGGAGG + Intergenic
1084672436 11:70615249-70615271 TCATCACAGAGTCCACCAGGAGG - Intronic
1085297192 11:75437906-75437928 TCACCCCTGTCCCCACCAGGAGG + Intronic
1086198548 11:84171619-84171641 TAACCTCAGTGTCCATCAGTGGG - Intronic
1087655217 11:100914567-100914589 TCACTTCAGAGTACACCAGGAGG - Intronic
1089526033 11:119097294-119097316 TCACCTCTGGTCCCTCCAGGTGG - Exonic
1089591945 11:119547240-119547262 ACAGCTCAGTCTCCCCCAGGGGG - Intergenic
1091057941 11:132436342-132436364 GCACTTCAGTGTCCAACAGGAGG + Intronic
1091119756 11:133047110-133047132 TCTCCTGAGTTTCCTCCATGAGG - Intronic
1091951495 12:4596580-4596602 TCACCTTAGGTTTCACCAGCAGG + Exonic
1098051624 12:66460124-66460146 TCACCTCTGACTCCACCACGTGG - Intronic
1099692968 12:85983831-85983853 TCACCTCATTTTTTACCTGGAGG + Intronic
1099872074 12:88362003-88362025 CCACTTCACTTTCCACCATGAGG - Intergenic
1104730370 12:131102453-131102475 TGACCTCAGCTCCCACCTGGTGG + Intronic
1104989103 12:132615075-132615097 TCTGCTCAGATGCCACCAGGTGG - Intergenic
1106236206 13:27862651-27862673 TCACCTCAGCTGACACCACGAGG - Intergenic
1111792239 13:92872075-92872097 TCACCTAAGTTACCCCCAAGTGG + Intronic
1121240834 14:92428790-92428812 TCAACTCAGTCTCCTCTAGGGGG - Intronic
1122154394 14:99741714-99741736 TCACCTCAGTTTCTCCTAGAAGG + Intronic
1122675822 14:103412500-103412522 GCACCTCAGTGTCCACTTGGGGG + Intronic
1122690414 14:103529491-103529513 TCACCCCAGTCTCCCCCACGGGG - Intronic
1124576101 15:30909762-30909784 CCAGGTCAGTTTCCACCACGTGG + Intronic
1125254326 15:37745342-37745364 CCACCTGAGTTTCCATCATGAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128471253 15:67955526-67955548 AAACCTCAGTTCCCACCACGTGG - Intergenic
1128887772 15:71304113-71304135 TCATCCCAGATACCACCAGGAGG + Intronic
1132546039 16:533899-533921 GCACCTCAGCTTCCACCAGGAGG - Intronic
1132639077 16:969430-969452 TCTCATCACTTTGCACCAGGAGG + Intronic
1134236285 16:12468724-12468746 CCTCCTCAGTCACCACCAGGTGG - Intronic
1135935313 16:26774953-26774975 TCACCCCAGTGTCCCCCAGTGGG + Intergenic
1138441531 16:57037834-57037856 TCAACTCAGTTCCCACTCGGAGG + Intronic
1138653921 16:58479354-58479376 CCACCTCAGTGAGCACCAGGAGG - Intronic
1141203383 16:81914201-81914223 GCACCTCAGTTTCAGCCAGTTGG - Intronic
1143363977 17:6393643-6393665 TCTCCTCAGTTTCTAACTGGAGG + Intergenic
1144490572 17:15704840-15704862 TCACCTCCTTGTACACCAGGCGG + Intronic
1146370323 17:32262094-32262116 TGACCTCATTTTCCCCCAGGAGG + Intergenic
1149291055 17:55218039-55218061 TGACCTCAGTTGCCACTTGGTGG + Intergenic
1151240736 17:72755801-72755823 TCTCCTCAGCTGCCACCACGTGG + Intronic
1151893967 17:76967880-76967902 TCACTGCAGCTTCAACCAGGAGG + Intergenic
1152710352 17:81868112-81868134 TCACCTCAGTACCATCCAGGAGG - Exonic
1152842184 17:82577085-82577107 TCACCGCAGTCTCCGCCATGTGG - Intronic
1154354008 18:13611099-13611121 TCACCGCAGGGTCCTCCAGGTGG - Intronic
1155640889 18:28013172-28013194 TCACAGCAGCTTCCACCAGAGGG + Intronic
1156346064 18:36258178-36258200 TCACCCCAGTTCCTACCAGGAGG + Intronic
1157084855 18:44569482-44569504 GCACTTCAGTATGCACCAGGTGG + Intergenic
1157136799 18:45063915-45063937 TCACCGCAGCTCCCACCACGCGG + Exonic
1157573635 18:48729989-48730011 TCACCTGAGACTCCACCTGGAGG - Intronic
1160401952 18:78618043-78618065 TCATCTTAGTGTCCACCAGAGGG - Intergenic
1162564119 19:11435733-11435755 GCACCTCAGTTTCTTACAGGGGG + Intronic
1163871503 19:19825073-19825095 ACACCTCTGTTTCAACCATGAGG + Intergenic
1164425561 19:28138493-28138515 TCACCTGAGTGCCCCCCAGGAGG + Intergenic
1164520856 19:28978009-28978031 TCAGCTCAGTGCCCACCAGGAGG + Intergenic
1164642646 19:29837832-29837854 TCACCTCAGGGATCACCAGGAGG - Intergenic
1167064868 19:47177615-47177637 TCACCTCAGTTTCCCAAAGAGGG + Intronic
1167434256 19:49470031-49470053 TCACATCTGTTACCAACAGGAGG - Intronic
1167766943 19:51489923-51489945 TCACCTCATCTTCCACCACCTGG + Intronic
1168301321 19:55406905-55406927 TCACCTCCTTGTACACCAGGCGG + Exonic
926093283 2:10064146-10064168 TCACCGCAGTCTCCACCACCCGG - Intronic
929429076 2:41871451-41871473 TCACCTCAGCCTCCCCCAGCTGG - Intergenic
930004119 2:46882482-46882504 TCACCTCAGCTCCCACCTGCCGG + Intergenic
933164248 2:79057799-79057821 TCACCTTAGTCTCCTCCAGTCGG - Intergenic
934976464 2:98806152-98806174 TCACATCAGTTTCTACTATGGGG - Intronic
935126459 2:100227723-100227745 TCCCCTCAGGTAGCACCAGGAGG + Intergenic
937080027 2:119134294-119134316 ACATCTCAGTTTCCAAGAGGAGG + Intergenic
940780695 2:157930714-157930736 TCACCCCATTTTCCACAGGGTGG + Intronic
942942370 2:181633208-181633230 TCAGCTCAGTTTCAGCCAAGTGG + Intronic
942984925 2:182128967-182128989 TCAACTCATTTTGCACCTGGAGG - Exonic
944464275 2:199984557-199984579 CCAGCTCAGTTCTCACCAGGTGG + Intronic
946311548 2:218884830-218884852 TGACCTCCGTTTCCTCCAAGTGG + Intronic
946765539 2:223036791-223036813 TCACCTCACTTTCCCCTGGGAGG - Intergenic
947610951 2:231524893-231524915 GCACCTCAGTTTCCCTCAGAGGG - Exonic
1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG + Intronic
1171015023 20:21532807-21532829 TCACCTCAGTTTAAGCCTGGTGG - Intergenic
1171267337 20:23782546-23782568 TCACCACAGTGACCACCAGAGGG + Intergenic
1171280195 20:23889868-23889890 TCACCACAGTGACCACCAGAGGG + Intergenic
1171285819 20:23937486-23937508 TCACCATAGTTACCACCAGAGGG + Intergenic
1172197526 20:33102279-33102301 TCAGCTCGGTGTCCAGCAGGAGG - Intronic
1174916881 20:54662976-54662998 TCAGCTGAGTTTCCAGCTGGAGG + Intergenic
1175754306 20:61519796-61519818 GCACCTCAGTTTCCTCCACGTGG - Intronic
1177612650 21:23471989-23472011 TCAGATGAGTTTCCACCTGGAGG + Intergenic
1179834966 21:44025051-44025073 ACAACTCAAATTCCACCAGGAGG - Intronic
1180748614 22:18109923-18109945 TCCCCTCACTTCCCCCCAGGTGG - Intronic
1181910430 22:26234138-26234160 ACACCCCAGTTTCCACAAGGTGG - Intronic
1182241676 22:28921013-28921035 TCACCTGAATTTCAAACAGGAGG + Intronic
1183053813 22:35288389-35288411 TCACCTCAGTTTCCTGCAGACGG - Exonic
1183558807 22:38553534-38553556 TCACCGCACTTTACCCCAGGTGG - Intronic
949231021 3:1750850-1750872 TCAGCTATGTTTCCACCAAGAGG + Intergenic
950557275 3:13703313-13703335 TACCCTCAGTTTCCTCCACGTGG - Intergenic
950559315 3:13712804-13712826 TCACCTCAGTTTTCTCCATGTGG - Intergenic
950559514 3:13713642-13713664 TCCTCTCAGTTTCCTCCAGGTGG - Intergenic
950559975 3:13715628-13715650 TCTCCTCAGTTCCCTCCACGTGG - Intergenic
950559988 3:13715667-13715689 TCCCCTCAGTTCCCACCACATGG - Intergenic
952157772 3:30661728-30661750 TCACCTCCTCTTCCACCAAGTGG - Intronic
953755307 3:45641024-45641046 TTACCTCAGTTTTCAGCAGAAGG + Intronic
957243549 3:77689717-77689739 TCAGGTCAGATTCCACCAGCAGG - Intergenic
957688750 3:83539465-83539487 TGACCTAAGTTTCCATCAGTGGG + Intergenic
964567780 3:158076477-158076499 TCACCCCAACTTCCAGCAGGTGG + Intergenic
966226055 3:177599262-177599284 TCCCCTCTGCTTCCACCAGTTGG - Intergenic
966953506 3:184847805-184847827 TCACCTCTGATTTCTCCAGGAGG - Intronic
968259342 3:197307190-197307212 TCAGCTCAGCTTTCAACAGGAGG + Intergenic
970493865 4:16605854-16605876 TTTCCTAAGTTACCACCAGGAGG + Intronic
973186750 4:47338728-47338750 TCACCTCCTTTTCTACCAAGCGG - Intronic
978491518 4:109316017-109316039 TGATATCAGTCTCCACCAGGGGG - Intergenic
986783353 5:11086807-11086829 TCACCTCAGTTTCAGCAAGGGGG - Intronic
988681772 5:33490478-33490500 TTACCTCATTATCCACTAGGGGG - Intergenic
989704578 5:44313487-44313509 TTAACTCACTTTCCTCCAGGAGG - Intronic
990417096 5:55597111-55597133 TCTGCTCGGTTTCCACCATGTGG - Intergenic
993087077 5:83376556-83376578 TGGCCTCAGTCTCCACCAAGGGG + Intergenic
999425814 5:151487160-151487182 TCACCGATCTTTCCACCAGGTGG - Intronic
1000073368 5:157762148-157762170 TCTGCTCAGTTACCACTAGGTGG + Intergenic
1003039379 6:2673040-2673062 TCACCTCAGGTACCAGCAGATGG + Intronic
1005638407 6:27772607-27772629 TCCCCGCAGTCTCCACCAGGCGG + Intergenic
1006831358 6:36970229-36970251 ACACCACAGTTTACCCCAGGGGG + Intronic
1009211323 6:60866666-60866688 TCACCCCAGTTTCCAGCAACTGG - Intergenic
1011204494 6:84876980-84877002 CCACTTCATTTTCCACCAGAGGG + Intergenic
1014635235 6:123837824-123837846 TCACATCACTTTCCACAAGATGG - Intronic
1016120457 6:140337147-140337169 TAACATCAGTCTCCACCAGGAGG + Intergenic
1016883101 6:148930586-148930608 TCACCTCTCTTTCCCCTAGGAGG - Intronic
1018033443 6:159862655-159862677 TTATCTCAGTTTCCACCAGTTGG + Intergenic
1018290884 6:162291581-162291603 TCACCTGACTTTCGAGCAGGAGG - Intronic
1018581871 6:165315005-165315027 TCTCCTCAGTAGCCTCCAGGAGG - Intergenic
1019216353 6:170446516-170446538 TCACCAGAGTTTGCATCAGGTGG - Intergenic
1019726771 7:2607144-2607166 CCACCGCAGCTTCTACCAGGAGG + Exonic
1024222734 7:47301221-47301243 TCACTCCAGCCTCCACCAGGTGG + Intronic
1024777036 7:52799648-52799670 ACACATCAGTTTCCATCACGCGG + Intergenic
1031710721 7:125043085-125043107 TCACATCATTTAACACCAGGTGG + Intergenic
1032524829 7:132572243-132572265 GCATCTCAGTTTCCTCCTGGAGG + Intronic
1033134547 7:138773813-138773835 TTACCCCAGCTTCCTCCAGGCGG + Intronic
1034556654 7:151854635-151854657 TCACCTCAGTTTGCACAATTGGG + Intronic
1034629751 7:152521876-152521898 AGGCCTCAGTTTCCACCATGTGG + Intergenic
1036294379 8:7523692-7523714 TCACCTAAACTTCCATCAGGAGG - Intergenic
1036328183 8:7797299-7797321 TCACCTAAACTTCCATCAGGAGG + Intergenic
1038478329 8:27884478-27884500 TCACCTCTGGCTGCACCAGGAGG + Intronic
1039835488 8:41253143-41253165 TCTCCACACTTTGCACCAGGAGG + Intergenic
1040476233 8:47780611-47780633 TCATCTCAGTTTAAACTAGGAGG - Intronic
1042436990 8:68777295-68777317 GCACCTCAGTTCTCTCCAGGTGG - Intronic
1047352523 8:124089162-124089184 TCAACTCAGGTTCCAACAGCTGG + Intronic
1048502772 8:134993852-134993874 TCACCTCAGCCTCCACTTGGAGG + Intergenic
1048538936 8:135324756-135324778 TCTCCTGAGTTTCCTCAAGGTGG - Intergenic
1050621683 9:7459505-7459527 TCAAGTCAGTTGTCACCAGGTGG - Intergenic
1051189914 9:14500484-14500506 AAACCTCAGTTTCCATCATGTGG + Intergenic
1052797426 9:32936205-32936227 TCTCCTCAGTATGCAACAGGAGG - Intergenic
1055441953 9:76345305-76345327 TCACCGCAGTTTCCGCCTGCCGG + Intronic
1056254177 9:84781620-84781642 TTGCCACTGTTTCCACCAGGGGG - Intronic
1056371961 9:85965274-85965296 CCACCTCAGTATCCATCAGTAGG + Intronic
1056816581 9:89806166-89806188 GCACCTCAGTTTCCACAACTGGG - Intergenic
1060329500 9:122653656-122653678 TAACCTCAATTTCAGCCAGGGGG - Intergenic
1062207405 9:135344807-135344829 TCACCACAGTGACCACCAGGTGG + Intronic
1062446662 9:136598119-136598141 ACACTTCAGTGACCACCAGGCGG + Intergenic
1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG + Exonic
1187224383 X:17361820-17361842 TTACTTCCGGTTCCACCAGGGGG + Intergenic
1187228268 X:17395116-17395138 TCACCTCAGTGGCCATAAGGTGG - Intronic
1187515941 X:19970220-19970242 TCACCTGTGTTTCCACCTGGGGG + Exonic
1188888001 X:35573924-35573946 TCAGCTCAGTTTCCTCCATAGGG + Intergenic
1191600743 X:63002453-63002475 ACACCTCACTTTTCACCAAGGGG - Intergenic
1194487938 X:94509561-94509583 TCACCTTAGTTTCGACCAGTGGG - Intergenic
1196031906 X:111100864-111100886 CTACCTCAGTCTCCAACAGGAGG + Intronic
1196688956 X:118538522-118538544 CCAACTCAGTTTTCACCATGGGG - Intronic
1198691856 X:139293124-139293146 CCTCCTCAGTTTCCACATGGGGG + Intergenic
1199195329 X:145022699-145022721 TGAGCTCATTTTCCACAAGGGGG + Intergenic
1199947450 X:152680312-152680334 GCACCTCAGTCTCAAACAGGGGG - Intergenic
1199962230 X:152788142-152788164 GCACCTCAGTCTCAAACAGGGGG + Intergenic