ID: 1170773185

View in Genome Browser
Species Human (GRCh38)
Location 20:19351982-19352004
Sequence CCGGAGCCTGTGTTTTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170773180_1170773185 5 Left 1170773180 20:19351954-19351976 CCTACAAGCAGAGCCTGAGGTGA 0: 1
1: 0
2: 11
3: 104
4: 574
Right 1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
1170773178_1170773185 27 Left 1170773178 20:19351932-19351954 CCTGGGTGTCATAGGTGGGGCTC 0: 1
1: 0
2: 1
3: 23
4: 122
Right 1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87
1170773183_1170773185 -8 Left 1170773183 20:19351967-19351989 CCTGAGGTGAGGACTCCGGAGCC 0: 1
1: 0
2: 1
3: 11
4: 238
Right 1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG 0: 1
1: 0
2: 1
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170773185 Original CRISPR CCGGAGCCTGTGTTTTATTG AGG Intronic
903687059 1:25139507-25139529 CAGGAGCCTGTGCCTTTTTGCGG - Intergenic
904961406 1:34336095-34336117 CCGGAACCTGGGTTTCAATGGGG - Intergenic
912391842 1:109308363-109308385 CAGGAGCCTGTGTTATCTTGGGG + Intergenic
1067213179 10:44278859-44278881 CTGGAGCCTGTGTGTTGCTGGGG + Intergenic
1075557188 10:123442035-123442057 CAGAAGCCTGTGTTTTCTTCAGG + Intergenic
1077326834 11:1967638-1967660 CCCGAGCCTGGGTTTTATTTTGG - Intronic
1086288440 11:85276201-85276223 AAGGAGCCTGTGTTATATGGAGG - Intronic
1088921471 11:114262359-114262381 CCGGGGCCTGTGTTGGGTTGGGG - Intronic
1089101981 11:115970669-115970691 CCGAATCCAGTATTTTATTGAGG - Intergenic
1089106297 11:116008631-116008653 CCGAATCCAGTATTTTATTGAGG - Intergenic
1089831732 11:121334937-121334959 CGGAAACCTGTGTTTTATTATGG - Intergenic
1091132883 11:133161135-133161157 CCTTTGACTGTGTTTTATTGTGG + Intronic
1202809815 11_KI270721v1_random:22818-22840 CCCGAGCCTGGGTTTTATTTTGG - Intergenic
1093503605 12:19839023-19839045 CTGAAGCCTGTGATTTCTTGAGG + Intergenic
1093539245 12:20261434-20261456 CTGGAGCTTGTGTTTTAATGGGG - Intergenic
1094434536 12:30406797-30406819 CTGGGGCTTGTGTTTTTTTGGGG + Intergenic
1096110288 12:49024731-49024753 CCTTAGCCTGAGTTTTTTTGGGG + Intronic
1096492877 12:52022765-52022787 CCTGAGGCTGTGTCTTCTTGGGG + Intergenic
1104241776 12:126997137-126997159 CTGGAGTCTATGATTTATTGGGG - Intergenic
1108473338 13:50788922-50788944 CGGGAGCCTGGGTTATATCGAGG + Intronic
1110446958 13:75595711-75595733 CAGGAGCCTTTGTTTTCTTCAGG + Intronic
1120018136 14:79497613-79497635 TGGGAGCCTGTGTTCTAGTGTGG - Intronic
1120563846 14:86030081-86030103 CCTGGGCCTGTATTTTATTGTGG - Intergenic
1121642769 14:95496933-95496955 CCGGAGCCATTGTTTTCTTAGGG + Intergenic
1128459825 15:67858730-67858752 TCTAAGCCTCTGTTTTATTGAGG + Intergenic
1129688992 15:77702500-77702522 ATGCAGCCTGTGTTTTGTTGAGG - Intronic
1131791694 15:95972544-95972566 CAGGAGCATGTGTTTCTTTGTGG - Intergenic
1133484515 16:6206480-6206502 AGGGAGCCTGTGTTTTGGTGAGG - Intronic
1134294527 16:12933838-12933860 CGGGAGCCTATGTTATAGTGGGG + Intronic
1145297278 17:21601582-21601604 CCTGTGACTGTGTTTTATTCAGG - Intergenic
1145366678 17:22271318-22271340 CCTGTGACTGTGTTTTATTCAGG + Intergenic
1145774023 17:27514207-27514229 GGTCAGCCTGTGTTTTATTGGGG + Intronic
1150753340 17:67887465-67887487 CTGGATTTTGTGTTTTATTGAGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157186553 18:45545362-45545384 CCTCAGCCTGAGTTTTATGGAGG - Intronic
1160365849 18:78325317-78325339 GCGTGGCCTCTGTTTTATTGGGG - Intergenic
1161080161 19:2306589-2306611 CCTGAGCATCTGTTTTATGGTGG + Intronic
1161589693 19:5123813-5123835 CAGGAGTCTGTGTTTGATTCTGG + Intronic
1163844948 19:19633452-19633474 TCAGTGCCTGTGTTTTAGTGGGG - Intronic
1167530208 19:50011139-50011161 CTTGAGCCTGTGTTTTATTGGGG - Intronic
929459643 2:42093405-42093427 TAGGAGTCTGAGTTTTATTGAGG + Intergenic
930854259 2:55995636-55995658 CCAGAGCCTGTGTTTGGTTGTGG - Intergenic
933821401 2:86115526-86115548 CTGGAGGCAGTGTTTTATTTTGG - Intronic
935583859 2:104783471-104783493 CTGGAGCCTGAGTTTTATTTGGG - Intergenic
941493235 2:166168515-166168537 TCTCAGCCTGTGTGTTATTGGGG - Intergenic
942086256 2:172446809-172446831 CAGTAGACAGTGTTTTATTGTGG + Intronic
948918912 2:241052371-241052393 CCGGAGCCCGTGTGTGAATGGGG + Exonic
1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG + Intronic
1170807512 20:19645751-19645773 CCTGAGCCCCTGTTTTATTTTGG - Intronic
1172619264 20:36308327-36308349 CAGGAGCCTCTTTTTTGTTGGGG + Intronic
1173753907 20:45498151-45498173 CCATAGCCTGTGGTTTATTATGG + Intergenic
1174863424 20:54113790-54113812 CAAGAGCCTGTGTTCTAGTGAGG + Intergenic
1176922517 21:14705261-14705283 GAGGAGCCTGTGTATCATTGTGG - Intergenic
1176971851 21:15275676-15275698 ACGGAGCATGGGTTTTATTTGGG + Intergenic
1182335685 22:29581859-29581881 TCGGAGACTGGGTTTTATTAAGG + Intergenic
950434962 3:12973962-12973984 CAGGAGGCTCTGTTTTCTTGTGG + Intronic
952323187 3:32296846-32296868 CGGCAGACTGTGTGTTATTGTGG + Intronic
953481384 3:43255228-43255250 CAGGTGCATGTGATTTATTGAGG - Intergenic
954632894 3:52056560-52056582 CCGGAGCCGCCGTTTAATTGGGG - Intergenic
956663620 3:71622068-71622090 CAGGAGCCTGTGGTCTCTTGGGG - Intergenic
960304022 3:116039500-116039522 CCAGTGCCTGTATTTTATGGAGG + Intronic
962872688 3:139511868-139511890 CCAGAGCCTGAGTTTTGGTGGGG - Intergenic
964404530 3:156335124-156335146 CTGGAGCCTTTGATTTCTTGTGG + Intronic
965900889 3:173640236-173640258 CTGAAGCCTGTATTTTAATGAGG + Intronic
966907828 3:184540473-184540495 TCTGAGCCTGTATTTTCTTGAGG + Intronic
968981203 4:3850578-3850600 CAGGAGCCTCTGCTTTTTTGGGG + Intergenic
971251557 4:24976904-24976926 GCAGAGCCTGTGTTCTAGTGTGG - Intronic
975992642 4:80274869-80274891 TAAGAGCCTGTGTTTTATTTTGG + Intronic
988793686 5:34632746-34632768 TTGGAGCCTGTGGTTTCTTGAGG - Intergenic
989169784 5:38462719-38462741 CAGGAGCCTGTGGTCTACTGAGG - Intronic
992066950 5:73118009-73118031 ACGGAACTTGTATTTTATTGAGG - Intergenic
997132508 5:131291311-131291333 CAGGAACCTGTGTTTTGTTAAGG - Intronic
999255533 5:150208131-150208153 AGGGAGCTTGTATTTTATTGTGG + Intronic
1000023149 5:157336308-157336330 CCGCAGGCTGTGTTTTGTTTAGG + Intronic
1000673417 5:164090569-164090591 CTGTAGACTGTGTTTAATTGGGG - Intergenic
1002712475 5:181203852-181203874 CCGGAGCTTGTGTTTCAGTCTGG - Intronic
1005913791 6:30334011-30334033 ACAAAGGCTGTGTTTTATTGAGG + Intronic
1014281558 6:119447569-119447591 CCAGAGCCTTTGTTTGCTTGGGG - Intergenic
1022102670 7:27177878-27177900 CCAGAGCCCATGTTTTATTTAGG + Intronic
1022982081 7:35613237-35613259 CCAGGGCTTGTGTTTTACTGGGG + Intergenic
1022982430 7:35617095-35617117 CCAGAGCTTGTGTTTCAATGGGG - Intergenic
1030312962 7:108086357-108086379 CAGGTGCATGTGTTTTATTGAGG - Intronic
1037591172 8:20313291-20313313 CCTGACCCTGAGTTTTGTTGCGG + Intergenic
1037803023 8:22045261-22045283 CAGGAGCCTCTGTTACATTGTGG + Intronic
1045684451 8:104697677-104697699 CCAGAGCCTGTATTTGATTTTGG - Intronic
1047001428 8:120576966-120576988 CCCCATCCTGTGTTTTACTGAGG - Intronic
1049932940 9:473627-473649 CAGGTGCCTGTGGTTTGTTGGGG - Intronic
1052475120 9:28949876-28949898 CAGGATCCAGTATTTTATTGAGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1059094652 9:111399709-111399731 CCTGGTCCTTTGTTTTATTGTGG - Intronic
1059355363 9:113695353-113695375 AGGGAGCCTGTGTTCTATTCTGG - Intergenic
1060717335 9:125944742-125944764 CTGGAGCCTGTGTTATTATGTGG + Intronic
1186541995 X:10410285-10410307 TCAGTGCCTGTGTTTTATTGGGG - Intergenic
1186584425 X:10857164-10857186 TCAGAGCCTGGATTTTATTGTGG + Intergenic
1189220957 X:39371472-39371494 CCTCAGCCTCTGTTTTCTTGAGG - Intergenic
1194455673 X:94099954-94099976 CTGGAGGCTGTGTGTTTTTGGGG + Intergenic
1195410564 X:104565065-104565087 CCGGAGCCTGTGCATGATTAAGG - Intergenic