ID: 1170774104

View in Genome Browser
Species Human (GRCh38)
Location 20:19360066-19360088
Sequence CCATAGGCATGAATGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170774098_1170774104 12 Left 1170774098 20:19360031-19360053 CCAGAGAACATCCTCAGGCAGAA 0: 1
1: 2
2: 2
3: 37
4: 250
Right 1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1170774100_1170774104 1 Left 1170774100 20:19360042-19360064 CCTCAGGCAGAAAGATGCAGGAA 0: 1
1: 0
2: 12
3: 54
4: 457
Right 1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1170774096_1170774104 19 Left 1170774096 20:19360024-19360046 CCTAGGGCCAGAGAACATCCTCA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170774104 Original CRISPR CCATAGGCATGAATGGAAAC TGG Intronic
900084475 1:884166-884188 CCATATGCAGAAATTGAAACTGG - Intergenic
902090928 1:13902531-13902553 CCAGAGGCAGGAAGGGAGACAGG + Intergenic
902930964 1:19731187-19731209 CCATGGGAAGGAGTGGAAACTGG + Intronic
903665285 1:25003369-25003391 ACATAAGCAAGAATGGAAAAGGG - Intergenic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
907772166 1:57476267-57476289 GTATAGTCATGAATGGAAAATGG + Intronic
908896736 1:68909680-68909702 ACACAGCCCTGAATGGAAACAGG + Intergenic
908995804 1:70152323-70152345 TCCTAGGTATGTATGGAAACTGG - Intronic
913263400 1:117021704-117021726 CAAGAGGCATTAGTGGAAACAGG - Exonic
914877185 1:151520712-151520734 CCGGAGGCATGAAGGAAAACAGG + Intronic
915580552 1:156810376-156810398 CCACAGGCACAAATGGAATCTGG - Intronic
915730531 1:158050632-158050654 CCTTAACCATGAATGGGAACTGG + Intronic
917148475 1:171918903-171918925 TCACAAGCATGAATTGAAACAGG + Intronic
923347727 1:233072339-233072361 CCATATGCAGAAATTGAAACTGG - Intronic
1063051979 10:2460521-2460543 CCATAACCAAGAATGGAAAAGGG - Intergenic
1064374744 10:14785269-14785291 CAATAGACATAAATGGAAACTGG + Intergenic
1068553955 10:58437188-58437210 CCATAAGCATGAATGTATAAGGG - Intergenic
1069155218 10:65021173-65021195 CCATATGCAGAAATTGAAACTGG + Intergenic
1069228511 10:65975206-65975228 ACATATGCATGAATAGATACAGG + Intronic
1071831896 10:89380285-89380307 CAATAAGCATGAATGGAAGGAGG - Intronic
1073615527 10:104991124-104991146 CCACAGGGATCAATGGAAACTGG - Intronic
1073660251 10:105467868-105467890 CAAAGGGCATGTATGGAAACAGG + Intergenic
1078628941 11:12984041-12984063 CCCTAGGCATGAAAGGACAAGGG - Intergenic
1078733437 11:13997906-13997928 CCAGAGGTATGAATGGATAGCGG + Intronic
1080641773 11:34162530-34162552 CCATATGCATGCATGGACATGGG + Intronic
1081534896 11:43989463-43989485 CCCCAGGCAGGAAAGGAAACAGG - Intergenic
1093415709 12:18918084-18918106 CCATATACAGAAATGGAAACTGG + Intergenic
1096112388 12:49037308-49037330 CCATAGCCATGGATGGAGCCAGG + Exonic
1102721298 12:115018683-115018705 CCATAGGACTCAATGGACACAGG - Intergenic
1104215209 12:126727297-126727319 CCACAGGCTAGAAGGGAAACAGG - Intergenic
1105821294 13:24083359-24083381 CCATGGGCAGGTAAGGAAACTGG + Intronic
1109633475 13:65083688-65083710 CCAAGGGCAATAATGGAAACAGG + Intergenic
1110601788 13:77383332-77383354 CCATATGAATGAAAGTAAACTGG - Intergenic
1112589952 13:100753847-100753869 CCATGGGAATTAATGGAAAAGGG + Intergenic
1113808692 13:113124328-113124350 CCATTGGCAGGAAGGGAAGCTGG - Intronic
1116600547 14:46916438-46916460 ACAAAGGCATTAATGGAAATAGG - Intronic
1119084960 14:71731121-71731143 ACATGGGTATGAATGGACACTGG - Intronic
1119609747 14:76051815-76051837 CCAAAGGCATGAAGAAAAACTGG - Intronic
1120021043 14:79530422-79530444 ACACAGGCATGAATGAACACAGG + Intronic
1120540346 14:85742922-85742944 CCACAGTCATGGATGGATACAGG + Intergenic
1120951329 14:90044860-90044882 CAACAGCCATGAAAGGAAACAGG + Intergenic
1122274254 14:100583305-100583327 ACAGAGGAATGAATGGACACTGG - Intronic
1123772240 15:23540237-23540259 CCTAAGGCATGAATGGACACAGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126240216 15:46433280-46433302 CCATAGGCATGAATTGGCAAGGG + Intergenic
1126283552 15:46985814-46985836 CCATATGCAGGAGTTGAAACTGG + Intergenic
1126424182 15:48508049-48508071 ACATAAGCAAGAAGGGAAACAGG - Intronic
1127080645 15:55375379-55375401 CCAGAGGCAGGAAAGGAAGCGGG + Intronic
1129618358 15:77119338-77119360 ACAGAGGCTTGAAGGGAAACTGG + Intronic
1132160394 15:99536315-99536337 CCCTATTAATGAATGGAAACTGG + Intergenic
1135144603 16:19950377-19950399 CCTGAGGGATGGATGGAAACAGG + Intergenic
1136573709 16:31111154-31111176 GCATAGGGATGAAGGGGAACCGG - Exonic
1137999246 16:53257203-53257225 ACATAGGCATGTATGGATACAGG + Intronic
1138232446 16:55348671-55348693 CCATAGGGAGGACTGGAAGCCGG + Intergenic
1138961708 16:62036202-62036224 CGAGAGGCATGAACGGAATCCGG - Exonic
1143741443 17:8956944-8956966 CCATAGCCATTCATGGATACTGG - Intronic
1144326579 17:14187874-14187896 ACAAGGGCATGAATGAAAACTGG - Intronic
1144475458 17:15584740-15584762 ACAAGGGCATGAATGAAAACTGG - Intronic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1145386004 17:22411798-22411820 CCATAGGCATGCAAGCAGACCGG - Intergenic
1150245359 17:63670679-63670701 CCTTAGGCATGAATGGGATTTGG + Intronic
1150933209 17:69607712-69607734 AAATAGGCATTAATGGAAAAGGG - Intergenic
1152396763 17:80037461-80037483 CGATAGGCATAAATGTAAAAGGG + Intronic
1154099865 18:11462650-11462672 CCATAGGCTTAAAAGGAAGCAGG - Intergenic
1158082701 18:53613142-53613164 AAATGGGAATGAATGGAAACTGG + Intergenic
1158327376 18:56326125-56326147 CCATATCCATGATTAGAAACAGG - Intergenic
1158343892 18:56495199-56495221 CCAGAGGGAAGAATGGATACTGG + Intergenic
1159404821 18:67986537-67986559 CCATAGGCTTGTATGGTAAGTGG + Intergenic
1162737214 19:12753399-12753421 CAAAAGGCATGAATGGATATGGG - Intronic
1164672792 19:30082442-30082464 CCATGGGCAGGAATGGGAAAGGG + Intergenic
1167602031 19:50459908-50459930 CCATAGGCAGGAATGGGAATGGG + Intronic
1167983580 19:53297046-53297068 ACAGAGGCCAGAATGGAAACAGG - Intergenic
925747442 2:7055712-7055734 TCATAGGCATGAATGAAATTTGG - Intronic
926444157 2:12923560-12923582 CCATAGGAATGAAAAGTAACAGG + Intergenic
927496616 2:23555555-23555577 CCTCGGGAATGAATGGAAACTGG - Intronic
929679587 2:43977949-43977971 CCATAGGCCTGTATGGTCACAGG - Intronic
929951685 2:46415016-46415038 AAATAGTCATGAAGGGAAACAGG + Intergenic
932996556 2:76861866-76861888 ACACAGGCATATATGGAAACAGG + Intronic
933459387 2:82562116-82562138 ACATAAGCATGCATTGAAACTGG - Intergenic
934107152 2:88705502-88705524 CCATATGCAAAAATTGAAACTGG + Intronic
937049930 2:118880124-118880146 CCATTGGCATCAGTGGAAAGCGG - Intergenic
940771363 2:157842379-157842401 CCAAAGGCATGAATGAATATGGG - Intronic
944432409 2:199647318-199647340 CCCTAGGCCTGAAGGGACACAGG - Intergenic
946363327 2:219232811-219232833 ACATAGTCTTGAATTGAAACTGG + Intronic
1169913800 20:10668266-10668288 ACATTGGGATGAATGGAAAGTGG - Intronic
1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG + Intronic
1172334258 20:34100819-34100841 CCAGAGGCATGGATGTAAACAGG + Intronic
1173037836 20:39429706-39429728 CCATGGGAATGGATGGGAACTGG - Intergenic
1182472402 22:30556592-30556614 CCATGGGCATGGATTCAAACGGG - Intronic
1184371222 22:44083372-44083394 CCATGGTCATGAATGGGACCTGG + Intronic
949626870 3:5877114-5877136 CTAGAGGCTGGAATGGAAACAGG - Intergenic
950250431 3:11460870-11460892 CCATACACATGGATGGAATCAGG - Intronic
950916263 3:16648347-16648369 CCATATGCAAAAATTGAAACTGG - Intronic
952074769 3:29682576-29682598 CCACAGGCAGGAGTTGAAACTGG + Intronic
952952281 3:38534399-38534421 CCATAGACAGGAATGCACACAGG - Intronic
956651332 3:71507151-71507173 CAATGGGCATGAAAGAAAACTGG - Intronic
957591502 3:82205192-82205214 CCACAGGCCTAAATGGAAAGAGG - Intergenic
958724679 3:97890013-97890035 CCAGAGGCAGGTATGGAAGCAGG + Intronic
966802719 3:183779207-183779229 CCAAAAGCAAGAATGAAAACGGG - Intronic
971221919 4:24716760-24716782 ACATAGCCAGGAATGGAACCTGG + Intergenic
971495430 4:27259204-27259226 CCAAAGGCATGGCTGGAAAGTGG + Intergenic
974518981 4:62956451-62956473 CCATATACATAAATTGAAACTGG + Intergenic
974730126 4:65853022-65853044 CTATAGCCATGAATGGAAGGTGG - Intergenic
975298003 4:72756318-72756340 CCATATGCAGAAATTGAAACTGG + Intergenic
975987505 4:80215183-80215205 CCAAAGTCATGATTGAAAACAGG + Intergenic
978155968 4:105489596-105489618 CCATATGCTAGAATGGAAATGGG - Intergenic
979960714 4:127017986-127018008 CCATGAGCATGAAGGGTAACTGG - Intergenic
981818780 4:148862240-148862262 CCATAGACATAACTGGAAAATGG - Intergenic
982157626 4:152536834-152536856 CCCTAGCCATGAAAGGAAACAGG + Intergenic
982352121 4:154427452-154427474 CAATAGTCATGGATGGAAAAAGG - Intronic
984279152 4:177647206-177647228 CCATAAACCTGTATGGAAACAGG + Intergenic
986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG + Intergenic
986768025 5:10945868-10945890 ACCTAGGCATGCATGGGAACTGG + Intergenic
988713836 5:33804801-33804823 CTATAGGAATGAATGGAATGGGG - Intronic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
988828916 5:34968728-34968750 CCAGTGGCATGCATGGAGACTGG + Intergenic
989159700 5:38378613-38378635 TCATAGGCATGGATTGAAAGAGG - Intronic
989664530 5:43838365-43838387 ACATAGGCATACATGAAAACAGG + Intergenic
990553229 5:56904871-56904893 CCATAGGCTTGAATGAAACCCGG + Intergenic
991091297 5:62696308-62696330 CCATTGGCATGAGTGGAAGGAGG - Intergenic
992753985 5:79887087-79887109 CCAGAGCCCAGAATGGAAACAGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994956962 5:106545042-106545064 CCATAGGCATACCTGGTAACAGG - Intergenic
995100197 5:108291760-108291782 ACATAGGTATTAATGGAAAGAGG - Intronic
997716347 5:136046029-136046051 ACAGAGGCAGGAATGGACACTGG - Intronic
998466481 5:142348532-142348554 CAATTGGCAGGAATGTAAACTGG + Intergenic
999105809 5:149069983-149070005 CCAAGGTCATGAATGGAAAGGGG + Intergenic
1001208638 5:169789154-169789176 CCAAAGGTATGAGTGGAGACAGG - Intronic
1006186385 6:32183880-32183902 CCAGCGGCTGGAATGGAAACTGG - Exonic
1009061540 6:58402551-58402573 TCACTGGCCTGAATGGAAACAGG - Intergenic
1009249212 6:61277099-61277121 TCACTGGCCTGAATGGAAACAGG - Intergenic
1011019435 6:82795620-82795642 CCAAAGGTAAGAATGAAAACAGG + Intergenic
1011850103 6:91616258-91616280 CCATCAGCTTGAATGGATACAGG - Intergenic
1014291273 6:119561542-119561564 TCATAGGCATGTATGGATATAGG + Intergenic
1019455194 7:1123204-1123226 CCACAGGCCTGAGTGGGAACCGG + Intronic
1022764591 7:33396946-33396968 CCATATGCAAAAATTGAAACTGG + Intronic
1022873594 7:34504912-34504934 CCATAGACATGGAGGGAGACTGG - Intergenic
1022925638 7:35053708-35053730 ACATAGCCCTGAATGGATACTGG + Intergenic
1023473642 7:40552688-40552710 CCATAGGCATGGAAGGAAAAGGG + Intronic
1024155996 7:46626219-46626241 GCCTAGGCATGAGTGGAAAGGGG - Intergenic
1027569954 7:79853430-79853452 GCATATGCATGAATGGCAAATGG - Intergenic
1027980300 7:85210683-85210705 CCATATTCAGAAATGGAAACTGG + Intergenic
1029238263 7:99142015-99142037 CTTTAGGGATGAATTGAAACTGG + Intronic
1030520427 7:110590972-110590994 CCACTGGCATGAATGGAAAAGGG - Intergenic
1030755324 7:113280922-113280944 CAATAGGCATAAAAGGAAATAGG - Intergenic
1032073275 7:128822979-128823001 CCACAGGAATGAAGGTAAACAGG - Intergenic
1032255099 7:130290888-130290910 CCAAAGGCAACAATGGAACCAGG - Intergenic
1035293936 7:157857274-157857296 CCATAGGCTTGAGGGAAAACAGG - Intronic
1035415765 7:158684309-158684331 CCATTGGCATGTGAGGAAACTGG - Intronic
1036815255 8:11897577-11897599 ACGTAGACATGAATGGAAAGTGG - Intergenic
1037177529 8:15964575-15964597 GGATATGCAGGAATGGAAACAGG + Intergenic
1038809205 8:30822784-30822806 CCATAAGAATAAATGGTAACTGG + Intergenic
1042347330 8:67740927-67740949 CAATAGTCATCCATGGAAACAGG - Intronic
1042540315 8:69901549-69901571 CCATAGGTGGGAATGCAAACTGG - Intergenic
1042558734 8:70056420-70056442 CCATAAGCATGCCTGGAAAGAGG - Intronic
1042582821 8:70300687-70300709 CCAGAGGAAGCAATGGAAACTGG + Intronic
1043654032 8:82639600-82639622 CCTGAGGGGTGAATGGAAACGGG - Intergenic
1050167009 9:2775721-2775743 CCATATGCAAAAATTGAAACTGG + Intronic
1055981313 9:82004969-82004991 CCAAAGGCAAGCATGGAACCAGG - Intergenic
1059012820 9:110481136-110481158 CGATAGGAATTAATGGAAAATGG - Intronic
1061554351 9:131357713-131357735 CCAAAGGCACGGGTGGAAACGGG + Intergenic
1185551259 X:984074-984096 CCATAGGTAGTATTGGAAACGGG - Intergenic
1185961828 X:4552883-4552905 CCATGGCCCTAAATGGAAACAGG - Intergenic
1186070401 X:5813360-5813382 ACATAAGCAAGCATGGAAACTGG - Intergenic
1186533107 X:10317305-10317327 CCATAGGCTTGAACTCAAACTGG + Intergenic
1189315276 X:40050997-40051019 CCATAAGCATCAAAGGAGACAGG + Intronic
1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG + Intergenic
1194378081 X:93160633-93160655 CCATATGCAGGAAATGAAACTGG + Intergenic
1195863381 X:109404829-109404851 TTATTGGCAAGAATGGAAACTGG + Intronic
1198328726 X:135601387-135601409 CCATATGCAAAAATTGAAACGGG - Intergenic
1198337723 X:135683579-135683601 CCATATGCAAAAATTGAAACTGG + Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic
1201300692 Y:12502280-12502302 CTATAGTCCTAAATGGAAACAGG + Intergenic