ID: 1170774673

View in Genome Browser
Species Human (GRCh38)
Location 20:19364986-19365008
Sequence CTCCATGTGGACCACAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170774669_1170774673 -3 Left 1170774669 20:19364966-19364988 CCAGGGATGCATCAGGCAGCCTC 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1170774673 20:19364986-19365008 CTCCATGTGGACCACAGAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 258
1170774668_1170774673 -2 Left 1170774668 20:19364965-19364987 CCCAGGGATGCATCAGGCAGCCT 0: 1
1: 0
2: 1
3: 17
4: 230
Right 1170774673 20:19364986-19365008 CTCCATGTGGACCACAGAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170774673 Original CRISPR CTCCATGTGGACCACAGAGA GGG Intronic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
901657397 1:10777293-10777315 CCCTATGAGGACCACGGAGAGGG + Intronic
901919880 1:12528315-12528337 TTCCCTGTTAACCACAGAGAAGG + Intergenic
904356486 1:29943402-29943424 CTCTATGGGGACAACAGAGCAGG + Intergenic
904380302 1:30106286-30106308 CACCAGGGGGACCACAGAGCAGG - Intergenic
905845006 1:41222108-41222130 CTTTATGTGGAATACAGAGAAGG + Intronic
907047434 1:51308049-51308071 GTCCACATGCACCACAGAGAAGG - Intronic
907064121 1:51462553-51462575 GTCCACATGCACCACAGAGAAGG + Intronic
907584060 1:55600588-55600610 CTCCTTGTGGAACATAGAAAAGG + Intergenic
907940604 1:59083667-59083689 ATCACTGTGGTCCACAGAGAAGG + Intergenic
910095808 1:83520173-83520195 ATCCTTGAGGACCAGAGAGAGGG - Intergenic
910867679 1:91803087-91803109 CTTCATCTGGACAGCAGAGATGG - Intronic
910934284 1:92474885-92474907 CTCCATGTGTACCATAGAGGGGG - Exonic
911046817 1:93635617-93635639 CTGCATGTGGGCCCCAGAGCGGG + Intronic
913090749 1:115475102-115475124 CTCCTGGTAGACCACAGGGAGGG + Intergenic
913106774 1:115621958-115621980 CGCTATGAGGCCCACAGAGAAGG + Intergenic
914747800 1:150512333-150512355 CCCACTGTGGACCAGAGAGAGGG - Exonic
915859146 1:159423451-159423473 CTCCCTGTGGAGCAAAGAGCAGG + Intergenic
918144443 1:181743169-181743191 CTCCATGTGGCCCAGAAAGCGGG - Intronic
919568438 1:199218374-199218396 CTGCTTGTGGCACACAGAGAAGG - Intergenic
920711286 1:208297360-208297382 GTGAATGAGGACCACAGAGAGGG - Intergenic
921075793 1:211699219-211699241 CTGCCTGTGGAGCACAGAGCGGG + Intergenic
1062875979 10:943339-943361 CTCCATGTGCATCCCACAGATGG - Intergenic
1064113733 10:12560028-12560050 CTCAATGCGGACCAGAGGGAGGG + Intronic
1065387088 10:25144331-25144353 CTGCATGTGGACCTGATAGATGG - Intergenic
1066356965 10:34694347-34694369 CTTCATGTGGACTGCAGAAAAGG + Intronic
1069860633 10:71468959-71468981 CTCCCTCAGGCCCACAGAGAAGG - Intronic
1069870502 10:71529958-71529980 TTACAAGTGGACCTCAGAGAGGG - Intronic
1069915681 10:71785270-71785292 CTCTAGGTGGACTCCAGAGATGG - Intronic
1071252576 10:83835941-83835963 CTCCATGTGAGACACAGTGAGGG + Intergenic
1071494376 10:86157674-86157696 TTCCATGGGGCCCACAGAGGTGG - Intronic
1071949161 10:90683203-90683225 ATGCATGTGGAACACACAGAGGG - Intergenic
1072798186 10:98372660-98372682 CTCCAGGTGGGTCACAGAGGTGG + Intergenic
1074441385 10:113480037-113480059 CCCCATGTGAATCACAGAGCTGG + Intergenic
1075160757 10:120022784-120022806 CTCAATGTGCAGCACAGCGAGGG + Intergenic
1076443286 10:130495172-130495194 CCCCATGAGGACCAGTGAGAAGG + Intergenic
1077535091 11:3120222-3120244 CTCCATGTGAAGCACACAGTAGG - Intronic
1079479681 11:20866136-20866158 CTCCTTGCGCATCACAGAGATGG - Intronic
1086330351 11:85747671-85747693 ATCACTGTGGTCCACAGAGAGGG + Intronic
1086985808 11:93247911-93247933 TTCCCTGTGGACTACAAAGAAGG - Intergenic
1087086937 11:94229541-94229563 CTACCTGGGGGCCACAGAGAAGG + Intergenic
1087222294 11:95559534-95559556 CTCCATGAGGAATACAGAGTTGG - Intergenic
1087309248 11:96521240-96521262 CTGCTTGTGGGGCACAGAGAAGG - Intergenic
1088597375 11:111450422-111450444 ATCCATCTTGACCACATAGAGGG - Intronic
1088837166 11:113587451-113587473 GTGCATGTGGGCCTCAGAGATGG - Intergenic
1088867347 11:113861144-113861166 CTCTGTCTGGACAACAGAGATGG + Intronic
1090128782 11:124117775-124117797 ATCCATGGGGAACACAAAGAAGG - Exonic
1091674153 12:2476218-2476240 CCCCATCTGGACCAGAGGGAAGG + Intronic
1091897747 12:4118784-4118806 CACCATGTGGTCCACTGAGGTGG - Intergenic
1091897990 12:4120174-4120196 CACCATGTGGTCCACTGAGGTGG - Intergenic
1092233863 12:6793348-6793370 CTGAATTTGGACCCCAGAGAAGG + Intronic
1092236743 12:6815187-6815209 CTCCATGTCCACCACACTGAGGG - Intronic
1095279458 12:40333546-40333568 CATGATGTGGGCCACAGAGAGGG + Intronic
1096650308 12:53059189-53059211 CTCCACGCTGACCACAGAGCCGG + Exonic
1096837295 12:54359019-54359041 CTCCCAGTGGACGAAAGAGAAGG + Intergenic
1098462160 12:70743720-70743742 CCCCACGTGGACCAAAGAGATGG + Intronic
1099978256 12:89569042-89569064 CTCCATATGGACTAGAGAGTAGG + Intergenic
1102350100 12:112185467-112185489 CTTCTTGTGGACCACGGACATGG - Exonic
1103554558 12:121758390-121758412 CTCCATGGTGACCACAGCGCGGG - Intronic
1103554569 12:121758427-121758449 CTCCATGGTGACCACAGCGCGGG - Intronic
1103554589 12:121758501-121758523 CTCCATGGTGACCACAGCGCGGG - Intronic
1103554620 12:121758612-121758634 CTCCATGGTGACCACAGCGCGGG - Intronic
1103554631 12:121758649-121758671 CTCCATGGTGACCACAGCGCGGG - Intronic
1103554659 12:121758760-121758782 CTCCATGGTGACCACAGCGCAGG - Intronic
1103554707 12:121758945-121758967 CTCCATGGTGACCACAGCGCGGG - Intronic
1103572798 12:121856401-121856423 CTCCCTGCCGGCCACAGAGATGG - Exonic
1103789332 12:123458399-123458421 CTCCCTGCGGCCCCCAGAGAAGG + Intronic
1104793417 12:131498799-131498821 TTCCATTTGGGCCACAGTGATGG - Intergenic
1108020913 13:46127013-46127035 CTCCAAGTGGCCCAGAGACAAGG + Exonic
1108777874 13:53788132-53788154 ATCCATTTGCATCACAGAGAGGG - Intergenic
1112837466 13:103533654-103533676 CTCTATGTAAAGCACAGAGAAGG - Intergenic
1113307858 13:109097377-109097399 GTGCATGTGGACCACCCAGAAGG - Intronic
1113444280 13:110353509-110353531 CTCCCTGAGGACCTCAGAGGAGG - Intronic
1113642254 13:111965975-111965997 CGCCGTGTGGGCCACAGAGCAGG - Intergenic
1118116127 14:62778930-62778952 CTCCCTGTTAACTACAGAGAAGG + Intronic
1118689933 14:68328604-68328626 TTCCATGTGAACCACATAGATGG - Intronic
1120122682 14:80701016-80701038 CTCCACGCAGAGCACAGAGAAGG - Intronic
1121170669 14:91851427-91851449 CTCTATTTAGACCACACAGAGGG - Intronic
1121452828 14:94020292-94020314 GTCCAGGTGGGGCACAGAGATGG - Intergenic
1122420345 14:101572488-101572510 CTCCATGTGCACAGCAGTGAGGG + Intergenic
1122420356 14:101572566-101572588 CTCCATGTGTACAGCAGTGAGGG + Intergenic
1122420368 14:101572644-101572666 CTCCATGTGCACAGCAGTGAGGG + Intergenic
1124168405 15:27350270-27350292 CTCCATGGGGCCCACAGAGCTGG + Intronic
1124994350 15:34708343-34708365 CACCCTGTAGACCACAGACAGGG + Intergenic
1125268601 15:37913385-37913407 CTGCATGTCTGCCACAGAGAGGG + Intergenic
1125339114 15:38657159-38657181 CTCCATGGGAACAGCAGAGAGGG - Intergenic
1126225056 15:46261221-46261243 CTGCTTGTGGGGCACAGAGAAGG - Intergenic
1126355205 15:47788070-47788092 CTCCATGTGGGCCTCTGATAAGG + Intergenic
1128662593 15:69513208-69513230 CTCTACCTGGACCACAGTGATGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130077483 15:80701872-80701894 CTGAAGGTGGACCAAAGAGAAGG - Intronic
1130596872 15:85255006-85255028 GTCTCTGAGGACCACAGAGAGGG + Intergenic
1131122831 15:89833749-89833771 CTCCATGATAAGCACAGAGATGG - Exonic
1132120146 15:99169132-99169154 CTCCCTGTGGGGCACAGAGCAGG + Intronic
1132146353 15:99432130-99432152 CCCCATATGGGCAACAGAGAAGG - Intergenic
1132380512 15:101362849-101362871 CACCCTGTGGTCCCCAGAGAGGG + Intronic
1132657603 16:1047927-1047949 CTCCACGGGGACCAAAGACAGGG + Intergenic
1132895980 16:2229601-2229623 CACGATGTGGGCCACAGTGATGG - Exonic
1133125036 16:3641191-3641213 CTCCATGTGGGCCACAGGGGAGG + Intronic
1133161620 16:3915748-3915770 CTCCATGTGCCCAGCAGAGAGGG - Intergenic
1135523656 16:23196938-23196960 CTCCATGTGGTCCTTTGAGATGG - Intronic
1136065441 16:27755263-27755285 CTGCAGGTGGACTCCAGAGATGG - Intronic
1138463921 16:57173034-57173056 TTCCCTTTGGACCTCAGAGAGGG + Intronic
1138976451 16:62214080-62214102 CTGCATGCGGGGCACAGAGAAGG - Intergenic
1139732939 16:68962882-68962904 CACCATGTTAGCCACAGAGATGG - Intronic
1140656346 16:77143881-77143903 CACCATGTGGACAGTAGAGATGG - Intergenic
1140804187 16:78517955-78517977 ATATGTGTGGACCACAGAGATGG + Intronic
1142083044 16:88160225-88160247 CTCCCTTTGGAGCAAAGAGACGG + Intergenic
1142716860 17:1751905-1751927 CTCCAGATGTACCACAGACAGGG - Intronic
1144874851 17:18392179-18392201 CACCATGAGGACGAAAGAGAAGG - Intergenic
1144939978 17:18932199-18932221 CTCTCTGTGGAGCACAGAGAAGG - Intergenic
1145157374 17:20552242-20552264 CACCATGAGGACGAAAGAGAAGG + Intergenic
1146531292 17:33609738-33609760 CTTCATGTGCCCCACAGATAAGG - Intronic
1147140278 17:38456735-38456757 CTCCCTTTGGGACACAGAGAGGG - Intronic
1148575830 17:48710405-48710427 CACCATGTTGACCACACTGATGG + Intergenic
1148807227 17:50270022-50270044 CTCCATGTGAAATGCAGAGAAGG + Intergenic
1148836166 17:50467009-50467031 CTCAATGTGGGCCACAGGAAAGG - Intronic
1149533679 17:57415748-57415770 GTCCATTTGGCACACAGAGAGGG - Intronic
1150718046 17:67588715-67588737 CTCCAAGAGGACAACATAGATGG + Intronic
1152121913 17:78424044-78424066 CTCCATGCGGTCCACAGGAATGG + Exonic
1152343596 17:79738383-79738405 ATCCCAGTGGAGCACAGAGATGG - Intronic
1152643147 17:81457524-81457546 CTCCATCTTGACCACAGAGGAGG - Exonic
1153795627 18:8619273-8619295 CTAGATGTGGACCACAGTGGTGG + Intronic
1155712605 18:28901726-28901748 CTCCATGGTGAGCACAAAGAGGG - Intergenic
1160802658 19:977439-977461 CTCCATCTGGGCCGCACAGAGGG - Intergenic
1161667426 19:5585797-5585819 CCCCATGTGCAACACAGAGGCGG + Intergenic
1163369637 19:16894627-16894649 CTTCCAGTGGACCACAGTGATGG + Intronic
1163625474 19:18386964-18386986 CTCCATGGAGGGCACAGAGATGG - Intronic
1164304965 19:23998022-23998044 CTTCTTGTGGACCACAGACATGG + Intergenic
1165285700 19:34839656-34839678 CTCCAGGGCGGCCACAGAGAAGG - Intergenic
1165437731 19:35805821-35805843 GTCCCTGTGGCCCCCAGAGAAGG + Intronic
1166087661 19:40487780-40487802 CTCTATGTGGACCTCCGGGACGG + Exonic
1166364893 19:42273358-42273380 GTCCATGCGAACCAAAGAGATGG + Intronic
925268666 2:2586207-2586229 CTCCATGTGGCCCATGGACATGG - Intergenic
926550024 2:14290020-14290042 GTGCATGTAGACCACAGAGAAGG - Intergenic
927404452 2:22751413-22751435 CACCCTGTGGTCCTCAGAGAAGG + Intergenic
929551881 2:42898817-42898839 CTCCAGGTGGACGGCAGAGTCGG - Intergenic
929779162 2:44946700-44946722 CTCCAGCTGAACCCCAGAGATGG - Intergenic
931836750 2:66107388-66107410 CACCATCTGGAGCACAGAGCAGG + Intergenic
932333901 2:70918440-70918462 CTCCTTGTGATCCACAGGGACGG - Intronic
932877882 2:75472614-75472636 CTCAAGGTGGAGGACAGAGATGG - Intronic
934058074 2:88269407-88269429 CTACCTGTGGTCCTCAGAGAGGG - Intergenic
934066708 2:88348293-88348315 ATCCATGTTGACCAGAGACAGGG - Intergenic
934614483 2:95762762-95762784 CTCCCTGTGGTCCAGAGAGTTGG - Intergenic
934646421 2:96061737-96061759 CTCCCTGTGGTCCAGAGAGTTGG + Intergenic
934839826 2:97617819-97617841 CTCCCTGTGGTCCAGAGAGTTGG + Intergenic
936121561 2:109750591-109750613 CCTCATGTGGACAAGAGAGAAGG - Intergenic
936223136 2:110620877-110620899 CCTCATGTGGACAAGAGAGAAGG + Intergenic
936868830 2:117109196-117109218 CTGCATGTGTGGCACAGAGAAGG - Intergenic
936909034 2:117571804-117571826 CTCTCTGTGAACCACAGACAGGG + Intergenic
936956775 2:118030249-118030271 CCCCATGAGGAACACAGAAAAGG - Intergenic
940904735 2:159158849-159158871 CTCCTTGTGGACCCCCTAGAGGG + Intronic
941203985 2:162548533-162548555 CTACATTGAGACCACAGAGAAGG + Intronic
944242462 2:197499702-197499724 CTCCAGCTGGACCGCAGAGGAGG + Intronic
944498383 2:200331875-200331897 CTCCAAGTGGACCGTAGAAATGG - Intronic
944926592 2:204471628-204471650 CTCCATGTTGGCCACTGCGAGGG + Intergenic
946710217 2:222497727-222497749 CTGCATGTGAACCCCAGAGCAGG - Intronic
947159200 2:227194526-227194548 GACCATGAGGACCACAGAAAGGG - Intronic
947545015 2:231004356-231004378 CTCCATGTTGACAACAGCAACGG - Intronic
947911310 2:233802697-233802719 CTCTGAGTGGACCACAGTGAGGG - Intronic
948155670 2:235778923-235778945 ATCCATGTGAGGCACAGAGAGGG - Intronic
948557645 2:238824662-238824684 GTACATCTGCACCACAGAGAAGG - Intergenic
948621350 2:239236659-239236681 GTCCATCTGGAGAACAGAGAAGG + Exonic
1169340799 20:4794943-4794965 TTCAATGTGGCCAACAGAGAGGG + Intronic
1169343834 20:4814926-4814948 CTCCACGTGGCCCGCAGAGGCGG + Intronic
1170544693 20:17425695-17425717 CTCCACCAGGAACACAGAGATGG - Intronic
1170774673 20:19364986-19365008 CTCCATGTGGACCACAGAGAGGG + Intronic
1171436110 20:25125873-25125895 CTCTATGTGAATCACAGGGAAGG + Intergenic
1172572663 20:35982607-35982629 CTACTTGAGGAGCACAGAGAAGG - Intronic
1172941390 20:38656943-38656965 GCACATGTGGACCACACAGAGGG + Intergenic
1175990849 20:62788203-62788225 CTCCATGAGGACAACATGGAAGG - Intergenic
1176284147 21:5010240-5010262 CTCCCTGGGGACCACAGAGTAGG - Intergenic
1179408333 21:41143275-41143297 CTTCATGTGGAGAAAAGAGAAGG + Intergenic
1179501635 21:41812952-41812974 ATGTATGTGGTCCACAGAGAGGG + Intronic
1179873034 21:44253235-44253257 CTCCCTGGGGACCACAGAGTAGG + Intronic
1180139069 21:45880362-45880384 GTCCCTGTGGCCCACAGAGGCGG - Intronic
1180945139 22:19688551-19688573 CCACATGTGAACCTCAGAGAGGG - Intergenic
1180979855 22:19873348-19873370 CTGCATGTGGACCACCCAGGGGG + Intergenic
1181559746 22:23693148-23693170 CTGCATGTGGACGGCAGAGATGG + Intronic
1183551329 22:38487893-38487915 CAGCTTGTGGACCACAGAGGAGG - Exonic
1184643782 22:45885509-45885531 CCCCATGGGGCCCACAGAGTTGG + Intergenic
1184767578 22:46579662-46579684 CTTCATGTGGCCCCCAGGGAGGG - Intronic
1185044995 22:48524347-48524369 CTCCATGCAGACCTCAGGGATGG + Intronic
949648981 3:6132876-6132898 CTCAATGTGTACCAAAGTGATGG - Intergenic
950920505 3:16689441-16689463 TGCCATGTAGACCACAGATAAGG + Intergenic
951082692 3:18470177-18470199 CTACTTCTGGACCCCAGAGATGG - Intergenic
951162254 3:19438795-19438817 CACAATGTGGACCAGAAAGAGGG - Intronic
952393087 3:32897663-32897685 ATCACTGTGGTCCACAGAGAAGG + Exonic
953637666 3:44676570-44676592 CTCCAGGTGGGCCCCAGTGAGGG + Intergenic
953669784 3:44952623-44952645 CTCCAAATAGACCACAGGGAGGG - Intronic
962825987 3:139101454-139101476 CTGCACGTGCAGCACAGAGAGGG + Intronic
963702746 3:148646093-148646115 CTCCATGCTGTCCACAGGGAAGG - Intergenic
967416073 3:189219937-189219959 GTCCATGTGGAACATATAGACGG + Intronic
967726254 3:192865045-192865067 CTCAATCTGGCCTACAGAGAAGG + Intronic
969099331 4:4757082-4757104 CTCCATGTGCACCACAGCCCTGG - Intergenic
969462860 4:7337955-7337977 ATCTGTGGGGACCACAGAGAGGG - Intronic
971151928 4:24042364-24042386 CTCATTCTGGACTACAGAGAAGG - Intergenic
973155009 4:46940307-46940329 CTCCATCTGTAGCCCAGAGAAGG + Intronic
974603708 4:64122397-64122419 CTGCTTGTGGTACACAGAGAAGG - Intergenic
974663048 4:64919927-64919949 CTGCTTGTGGGTCACAGAGAAGG + Intergenic
975330210 4:73104365-73104387 CTCCACGTGGACCCCAGTGAAGG + Intronic
977741369 4:100487424-100487446 CTCTATGTGGAGCCCAGAAAAGG - Intronic
979216602 4:118171774-118171796 CTCCTTTTGGAAAACAGAGAGGG - Intronic
979663272 4:123283118-123283140 CTCCATGGAAACCAGAGAGATGG - Intronic
981163320 4:141525350-141525372 CTACATGTGGGCCATTGAGAGGG + Intergenic
982139459 4:152304188-152304210 CTCCTCGTGGTCCACAGGGAGGG + Intergenic
985930843 5:3056522-3056544 CTCAATGTGGACCTCTAAGAAGG - Intergenic
986018519 5:3779386-3779408 CTCCTGGTGGTTCACAGAGAAGG + Intergenic
986112548 5:4734144-4734166 CTCAATGTTGAGCACAGAGGAGG - Intergenic
987853491 5:23387624-23387646 CGGCATGTGGACCTCAGGGAAGG + Intergenic
989089159 5:37711490-37711512 CTCCATGAGGACCAGAGCAAAGG - Intronic
989190389 5:38664983-38665005 CTGTCTGTGGAACACAGAGATGG + Intergenic
990620291 5:57551570-57551592 CTCCATATGGACCAAATGGAGGG - Intergenic
990781756 5:59372593-59372615 CTGCTTGTGGGGCACAGAGAAGG + Intronic
995691437 5:114830152-114830174 CTCCTTGTGGGGCACAGAGAAGG + Intergenic
996763017 5:127004891-127004913 CTCCATGGGAAAAACAGAGATGG - Intronic
998919476 5:147052032-147052054 CTTAATGAGGTCCACAGAGAAGG + Intronic
1002071387 5:176680568-176680590 CTCCGTGTGGCCCCCAGGGAGGG + Intergenic
1002478667 5:179484922-179484944 CTCCATGTTGCCCACAGAAGAGG - Intergenic
1003005501 6:2377315-2377337 ATACCTGTGGACCACATAGATGG + Intergenic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1003468208 6:6401805-6401827 CTCCAAGTGGACCATTGGGAGGG - Intergenic
1003749807 6:9042631-9042653 TTCCATGTGGACCTCTGAGCAGG + Intergenic
1003999467 6:11583306-11583328 CCACATGTGGACCTCAGAAATGG - Exonic
1004163424 6:13234450-13234472 CTCCATGAGGACCACAGACTTGG - Intronic
1005824426 6:29624215-29624237 CTCCAGATGGAAGACAGAGAAGG - Intronic
1007753811 6:44085964-44085986 CTCCCTGTGGACCTCAGATGTGG - Intergenic
1007835290 6:44669263-44669285 TTCCATGTGGCCCACACAAATGG - Intergenic
1009830078 6:68919060-68919082 CTCACTGTGGACAATAGAGAAGG - Intronic
1012958963 6:105602063-105602085 GGGCATGTGGACCCCAGAGAGGG - Intergenic
1013312668 6:108911150-108911172 CTGAATGTGGAAAACAGAGAAGG - Intronic
1014948758 6:127529117-127529139 CTCTATGTGGATAAGAGAGATGG - Intronic
1015325562 6:131919216-131919238 CTGCTTGTGGGGCACAGAGAAGG + Intergenic
1017749051 6:157472350-157472372 CTCCATGTGGAGGACTGGGATGG + Intronic
1018002991 6:159596318-159596340 CCCACTGTGGACCACAGAGCTGG - Intergenic
1018330688 6:162724879-162724901 CTGCCTGGGCACCACAGAGAAGG + Intronic
1019133075 6:169891440-169891462 CTCCATGAGGCTCACAGTGATGG - Intergenic
1019133135 6:169891830-169891852 CTCCATGAGGCTCACAGTGATGG - Intergenic
1020091703 7:5345608-5345630 CTCCAGCTGTACCACAGACAGGG + Exonic
1022469825 7:30675250-30675272 CTCCCTGAGGATCACTGAGATGG + Intronic
1023609115 7:41956451-41956473 CTCCATGATGACCTCAGATAAGG + Intergenic
1026373707 7:69728210-69728232 CTCCATGTGCCCCAGGGAGAGGG - Intronic
1030344727 7:108419866-108419888 GTCCAGGTGCACCTCAGAGAAGG + Intronic
1030690399 7:112526620-112526642 CTCCATGTAGACCACAAAATAGG + Intergenic
1031101158 7:117481214-117481236 CTCCCTGTGGATGAGAGAGAAGG + Intronic
1031310253 7:120187541-120187563 CTACATTTGAACCACAGAGGTGG - Intergenic
1032274865 7:130445462-130445484 TTCCATGTGGCCCACAGAGGTGG - Intergenic
1034479247 7:151307291-151307313 CTCTATGGGGAACACAGGGAGGG - Intergenic
1036163183 8:6407190-6407212 CTCCAGGTGGGCCTCAGAGGGGG - Intronic
1038414658 8:27385563-27385585 CTCCACATGGCCCACAGAGAGGG - Intronic
1039010752 8:33090280-33090302 CTGCATGTGCACCACAGACTGGG + Intergenic
1042310508 8:67374703-67374725 GTTCAGGTGGACCAGAGAGAAGG - Intergenic
1049337286 8:142093286-142093308 CTTCACTTGGACCAGAGAGAAGG + Intergenic
1049727023 8:144151775-144151797 CTCTAGGGGGAGCACAGAGACGG - Intronic
1049750368 8:144280267-144280289 CTGGGTGTGGACCACAGAGCTGG - Intronic
1052405913 9:28060641-28060663 CTACATATGGAGCACACAGAGGG - Intronic
1055661548 9:78508710-78508732 CTCCATGTGGTCAGGAGAGATGG + Intergenic
1055690808 9:78828376-78828398 CTCAATGTGGACCTGAAAGAAGG + Intergenic
1056712582 9:89002607-89002629 CTCCCTGTTGTTCACAGAGAGGG + Exonic
1056823589 9:89861299-89861321 CTCCATGTGGAAAAGGGAGAAGG + Intergenic
1056907359 9:90665362-90665384 CTGCTTGTGGGGCACAGAGAAGG - Intergenic
1057350895 9:94297519-94297541 TTCCATCTGGAATACAGAGAAGG - Intronic
1061194811 9:129102026-129102048 CTGGATGTGTACCACAGTGACGG - Exonic
1061258383 9:129465977-129465999 CTACATGTGGAGGGCAGAGAAGG - Intergenic
1062054398 9:134463482-134463504 CTCCAGGTGAAGCACAGAGTTGG + Intergenic
1187257988 X:17658634-17658656 TTCCATGGGGAACACAAAGATGG - Intronic
1188491170 X:30740238-30740260 GTCCCTGGGGACTACAGAGATGG + Intergenic
1189195352 X:39147892-39147914 CTCCATGTGGAGCACCCAGTGGG + Intergenic
1190534982 X:51417145-51417167 CTCCATGTGGATCCCAGAGGTGG + Intergenic
1190937112 X:55007278-55007300 CTCCCTGTGGCCCCCACAGAGGG - Exonic
1192233907 X:69284345-69284367 CTTCCTGTAGACCCCAGAGAGGG - Intergenic
1192684527 X:73289384-73289406 CTCCTTGTGGGGCACAGAGAAGG + Intergenic
1195119032 X:101730936-101730958 ATCCATGTGGCCCACAGATCCGG - Intergenic
1195346441 X:103954713-103954735 CTGCTTGTGGGGCACAGAGAAGG + Intronic
1195567808 X:106363203-106363225 CTGCTTGTGGGGCACAGAGAAGG - Intergenic
1196017542 X:110955779-110955801 CTCCAAGTTTTCCACAGAGAAGG - Intronic
1199099470 X:143781765-143781787 ATCCCTGTGGTCCACAGTGAGGG + Intergenic
1202095728 Y:21246670-21246692 CTCCTGGTGGCCCAAAGAGATGG + Intergenic